Query (optional)   in Class  

GrainGenes Marker Report: GDM111

[ Printable Version ]  [ Submit comment/correction ]

Probe
GDM111
Locus
Xgdm111-1D
Xgdm111
gdm111
Remarks
Repeat sequence: (CA)13
Type
PCR
SSR
PCR primers
Left CACTCACCCCAAACCAAAGT
Right GATGCAATCGGGTCGTTAGT
Amplification Conditions
Tm = 60 C
Source Species
Aegilops tauschii



Locus for Probe
gdm111
Type
Microsatellite
Map
Wheat, Yr genes and QTL 1D92
Wheat_2017_LRC-1D44.4
[ Show Nearby Loci ]
Map Data
Wheat, Yr genes and QTL
Wheat_2017_LRC
Probe
GDM111
Possible Orthologs
Xgdm111
Xgdm111-1D



Locus for Probe
Xgdm111
Type
Microsatellite
Chromosome
1D
Map
Wheat, Avalon x Cadenza 1D107.2
Wheat-Composite2004-1D137
[ Show Nearby Loci ]
Map Data
Wheat, Avalon x Cadenza
Wheat, Composite, 2004
Probe
GDM111
Possible Orthologs
Xgdm111-1D
gdm111



Locus for Probe
Xgdm111-1D
Type
Microsatellite
Chromosome
1D
Chromosome Arm
1DL
Map
Ta-SSR-2004-1D116
Ta-Synthetic/Opata-GPW-1D169.1
Ta-Synthetic/Opata-SSR_D-1D160.7
[ Show Nearby Loci ]
Map Data
Wheat, Consensus SSR, 2004
Wheat, Synthetic x Opata, GPW
Wheat, Synthetic x Opata, SSR-D
Probe
GDM111
Reference
ReferenceSomers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114.
ReferencePestsova E et al. (2000) Isolation and mapping of microsatellite markers specific for the D genome of bread wheat Genome 43:689-697.
Possible Orthologs
Xgdm111
gdm111