Query (optional)   in Class  

GrainGenes Marker Report: GDM35

[ Submit comment/correction ]

Probe
GDM35
Locus
Xgdm35-2D
Lr39
Remarks
Repeat sequence: (CA)26
Type
PCR
SSR
PCR primers
Left CCTGCTCTGCCCTAGATACG
Right ATGTGAATGTGATGCATGCA
Amplification Conditions
Tm = 55 C
Source Species
Aegilops tauschii



Locus for Probe
Lr39
Type
Gene
Trait
Chromosome
2D
Chromosome Arm
2DS
Map
Wheat-Composite2004-2D15
[ Show Nearby Loci ]
2 Point Data
Lr39/Xgdm35
Species
Triticum aestivum
Probe
GDM35
Associated Gene
Lr39 (Triticum)
Gene Class
Reaction to Puccinia recondita Rob. ex Desm.
Data Source
Soria, Marcelo A.
Remark
Trait marker Xgdm35-2D
Nearby marker on Composite map: Xbcd18.2
Position on Composite map estimated by GrainGenes.



Locus for Probe
Xgdm35-2D
Type
Microsatellite
Chromosome
2D
Chromosome Arm
2DS
Map
Chinese_Spring_Deletion_SSR_2D-0.735
Ta-Synthetic/Opata-SSR_D-2D15.7
Triticum-AxF-2D4.7
[ Show Nearby Loci ]
Breakpoint Interval
2DS5-0.47-1.00
Map Data
Wheat, Arina x Forno
Wheat, Physical, SSR
Wheat, Synthetic x Opata, SSR-D
2 Point Data
Lr39/Xgdm35
Species
Triticum aestivum
Probe
GDM35
Reference
ReferencePaillard S et al. (2003) An integrative genetic linkage map of winter wheat (Triticum aestivum L.) Theoretical and Applied Genetics 107:1235-1242.
ReferencePestsova E et al. (2000) Isolation and mapping of microsatellite markers specific for the D genome of bread wheat Genome 43:689-697.

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.