Query (optional)   in Class  

GrainGenes Marker Report: GMS061

[ Printable Version ]  [ Submit comment/correction ]

Locus
GMS061
Type
Microsatellite
Synonym
SynonymGMS61
Chromosome
5H
Map
Hordeum-Consensus2005-SNP-5H145.195
[ Show all 9 ]
[ Show Nearby Loci ]
Map Data
Barley, Abiotic QTL Consensus
[ Show all 9 ]
Species
Hordeum spontaneum
Hordeum vulgare
Probe
GMS61
Reference
ReferenceVarshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091.
ReferenceRostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
ReferenceMesfin A et al. (2003) Quantitative trait loci for fusarium head blight resistance in barley detected in a two-rowed by six-rowed population Crop Science 43:307-318.
ReferenceStruss D and Plieske J (1998) The use of microsatellite markers for detection of genetic diversity in barley populations. Theoretical and Applied Genetics 97:308-315.
Remark
Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb'
[ Show all 6 ]



Probe for Locus
GMS61
Locus
GMS0061
GMS061
Reference
ReferenceHayden MJ et al. (2008) Multiplex-Ready PCR: A new method for multiplexed SSR and SNP genotyping BMC Genomics 9:80.
ReferenceVarshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091.
ReferenceHearnden PR et al. (2007) A genetic map of 1,000 SSR and DArT markers in a wide barley cross. Theoretical and Applied Genetics 115:383-391.
ReferenceStruss D and Plieske J (1998) The use of microsatellite markers for detection of genetic diversity in barley populations. Theoretical and Applied Genetics 97:308-315.
General Remarks
Annealing temperature = 60 deg C
Insert contains repeat (ga)16
Type
SSR
PCR primers
5' CACCTGTTCCGTCCCGTC
5' AACCTCTTTTTTATCCCTCGC
CACCTGTTCCGTCCCGTC
AACCTCTTTTTTATCCCTCGC
Forward CACCTGTTCCGTCCCGTC
Reverse AACCTCTTTTTTATCCCTCGC
SSR size
145