Query (optional)   in Class  

GrainGenes Marker Report: GPW1019

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW1019
Locus
Xgpw1019-6D
Xgpw1019
Reference
ReferenceSourdille P et al. (2004) Wheat Genoplante SSR mapping data release: a new set of markers and comprehensive Genetic and physical mapping data.
Remarks
Motif (GC)10(TG)13
Type
PCR
SSR
PCR primers
Forward AATTCGATGACTTTGGGGTG
Reverse AAGCCCAGGCTAATTCTGGT
SSR size
Expected 300
Amplification Conditions
Tm = 60C
Linkage Group
6D
Source Species
Aegilops speltoides
Triticum aestivum
Data Source
Sourdille, Pierre2009.09



Locus for Probe
Xgpw1019
Type
Microsatellite
Chromosome
6D
Map
Wheat-Composite2004-6D87
[ Show Nearby Loci ]
Map Data
Wheat, Composite, 2004
Probe
GPW1019
Possible Orthologs
Xgpw1019-6D



Locus for Probe
Xgpw1019-6D
Type
Microsatellite
Map
Chinese_Spring_Deletion_SSR_6D-0.62
Ta-Synthetic/Opata-GPW-6D80.5
[ Show Nearby Loci ]
Breakpoint Interval
6DS2-0.45-0.79
Map Data
Wheat, Physical, SSR
Wheat, Synthetic x Opata, GPW
Probe
GPW1019
Possible Orthologs
Xgpw1019