Query (optional)   in Class  

GrainGenes Marker Report: GPW3248

[ Printable Version ]  [ Submit comment/correction ]

Locus
gpw3248
Type
Microsatellite
Map
Durum Wheat, NSGC Lr 3B18.6
Physical-3B16.89
Wheat, Yr genes and QTL 3B20.8
[ Show Nearby Loci ]
Map Data
3B Physical
Durum Wheat, NSGC Lr
Wheat, Yr genes and QTL
Probe
GPW3248
Possible Orthologs
Xgpw3248-3B
gpw3248-3B



Probe
GPW3248
Locus
Xgpw3248-3B
gpw3248
gpw3248-3B
Remarks
Motif (AG)28
Type
PCR
SSR
PCR primers
Forward CATGGACAGAGACGACAGGA
Reverse AAAAATGCACGTCCCAAAAT
SSR size
Expected 246
Amplification Conditions
Tm = 60C
Linkage Group
3B
Source Species
Triticum turgidum ssp. durum
Data Source
Sourdille, Pierre2009.09



Locus for Probe
gpw3248-3B
Type
Microsatellite
Map
Wheat_AB, Meridiano x Claudio 3B_141.9
Wheat_AB_2015_Consensus-3B18.6
[ Show Nearby Loci ]
Map Data
Wheat_AB, Meridiano x Claudio
Wheat_AB_2015_Consensus
Probe
GPW3248
Possible Orthologs
gpw3248
Xgpw3248-3B



Locus for Probe
Xgpw3248-3B
Type
Microsatellite
Map
Ta-Synthetic/Opata-GPW-3B26.6
[ Show Nearby Loci ]
Map Data
Wheat, Synthetic x Opata, GPW
Probe
GPW3248
Possible Orthologs
gpw3248
gpw3248-3B