Query (optional)   in Class  

GrainGenes Marker Report: GPW7052

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW7052
Locus
Xgpw7052-1A
Remarks
Motif (GCA)6(CAA)6
Type
PCR
SSR
PCR primers
Forward ATTCGGCACCAGCATCTACT
Reverse GGTTTCGTACAACGGCACAT
Amplification Conditions
Tm = 60C
Linkage Group
1A
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09



Locus for Probe
Xgpw7052-1A
Type
Microsatellite
Map
Ta-Synthetic/Opata-GPW-1A4.8
[ Show Nearby Loci ]
Map Data
Wheat, Synthetic x Opata, GPW
Probe
GPW7052