Query (optional)   in Class  

GrainGenes Marker Report: GPW7213

[ Printable Version ]  [ Submit comment/correction ]

Probe
GPW7213
Locus
Xgpw7213-3A
Remarks
Motif (CGCCG)3
Type
PCR
SSR
PCR primers
Forward GAGACCACCTTCGCGCC
Forward GAGACCACCTTCGCGCC
Reverse CGACGAGCCTGACAAGATTC
Reverse CGACGAGCCTGACAAGATTC
SSR size
Expected 151
Amplification Conditions
Tm = 60C
Linkage Group
3A
Source Species
Triticum aestivum
Data Source
Sourdille, Pierre2009.09



Locus for Probe
Xgpw7213-3A
Type
Microsatellite
Map
Ta-Synthetic/Opata-GPW-3A122.1
[ Show Nearby Loci ]
Map Data
Wheat, Synthetic x Opata, GPW
Probe
GPW7213