Query (optional)   in Class  

GrainGenes Marker Report: HVM002B-2

[ Printable Version ]  [ Submit comment/correction ]

Locus
HVM002B-2
Type
Microsatellite
Synonym
Other nameHVM2b
SynonymHVM2
Chromosome
7H
Map
Hordeum-Bins-7H73.5
Hordeum-Consensus2005-SNP-7H83.987
Hordeum-QTLConsensus-Abiotic-7H83.99
Hordeum-QTLConsensus-Agronomic-7H83.99
Hordeum-StMo-SNP-7H70.67
[ Show Nearby Loci ]
Map Data
Barley, Abiotic QTL Consensus
Barley, Agronomic QTL Consensus
Barley, BinMap 2005
Barley, Consensus 2005, SNP
Barley, Steptoe x Morex, SNP
Probe
HVM2
Reference
ReferenceRostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.



Probe for Locus
HVM2
Locus
HVM2a
HVM2b
HVM002B-1
HVM002B-2
HVM2
Reference
ReferenceLiu Z-W et al. (1996) Development of simple sequence repeat DNA markers and their integration into a barley linkage map. Theoretical and Applied Genetics 93:869-876.
General Remarks
Insert contains repeat (GA)11.
Type
PCR
SSR
PCR primers
5' CAGGTGTCTAGTGGGTGCCT 3'
5' TTACATACCAAGGAGCAATCCC 3'
SSR size
0.201
Amplification Conditions
The 'touchdown' PCR comprised 48 cycles of 94oC for 1 min denaturing and 72oC for 1 min extension. Annealing (30 s) temperatures were progressively decreased by 1oC every second cycle from 64oC to 55oC. Annealing conditions of 1 min at 55oC were maintained during the final 30 cycles. The reaction ended with a 5-min extension at 72oC.
Insert Enzyme
TaqI
Source Species
Hordeum vulgare
Source Germplasm
Old ZZ (barley)
DNA Origin
Size-fractionated genomic library screened with synthetic dinucleotide repeats (CA)10 and (GA)10.
Clone Vector
pGEM-7zf(+)
Vector Enzyme
ClaI
Data Source
Saghai Maroof, M.A.97.01.02