Query (optional)   in Class  

GrainGenes Marker Report: HVM14

[ Printable Version ]  [ Submit comment/correction ]

Locus
HVM14
Type
Microsatellite
Synonym
Correct nameHVM014
SynonymHVM14
Chromosome
6H
Map
Barley-consensus-2003-6H17.5
[ Show all 11 ]
[ Show Nearby Loci ]
Map Data
Barley consensus 2003
[ Show all 11 ]
Species
Hordeum spontaneum
Hordeum vulgare
Probe
HVM14
ReferenceLiu Z-W et al. (1996) Development of simple sequence repeat DNA markers and their integration into a barley linkage map. Theoretical and Applied Genetics 93:869-876.
Reference
ReferenceVarshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091.
ReferenceRostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
ReferenceLiu Z-W et al. (1996) Development of simple sequence repeat DNA markers and their integration into a barley linkage map. Theoretical and Applied Genetics 93:869-876.
Data Source
Langridge, Peter J.
Remark
Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb'
[ Show all 6 ]



Probe
HVM14
Locus
HVM14
HVM014
Reference
ReferenceVarshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091.
ReferenceLiu Z-W et al. (1996) Development of simple sequence repeat DNA markers and their integration into a barley linkage map. Theoretical and Applied Genetics 93:869-876.
Remarks
Insert contains repeat (CA)11.
Type
PCR
SSR
PCR primers
5' CGATCAAGGACATTTGGGTAAT 3'
5' AACTCTTCGGGTTCAACCAATA 3'
CGATCAAGGACATTTGGGTAAT
AACTCTTCGGGTTCAACCAATA
SSR size
0.158
Amplification Conditions
The 'touchdown' PCR comprised 48 cycles of 94oC for 1 min denaturing and 72oC for 1 min extension. Annealing (30 s) temperatures were progressively decreased by 1oC every second cycle from 64oC to 55oC. Annealing conditions of 1 min at 55oC were maintained during the final 30 cycles. The reaction ended with a 5-min extension at 72oC.
Insert Enzyme
TaqI
Source Species
Hordeum vulgare
Source Germplasm
Old ZZ (barley)
DNA Origin
Size-fractionated genomic library screened with synthetic dinucleotide repeats (CA)10 and (GA)10.
Clone Vector
pGEM-7zf(+)
Vector Enzyme
ClaI
Data Source
Saghai Maroof, M.A.97.01.02



Locus for Probe
HVM014
Type
Microsatellite
Synonym
Other nameHVM14
Map
Hordeum-Bins-6H65
[ Show Nearby Loci ]
Map Data
Barley, BinMap 2005
Probe
HVM14