Query (optional)   in Class  

GrainGenes Marker Report: HVM22

[ Printable Version ]  [ Submit comment/correction ]

Locus
HVM22
Type
Microsatellite
Synonym
Correct nameHVM022
SynonymHVM22
Chromosome
6H
Map
Hordeum-Consensus2005-SNP-6H71.558
Hordeum-QTLConsensus-Abiotic-6H71.56
Hordeum-QTLConsensus-Agronomic-6H71.56
Hordeum-StMo-SNP-6H62.7
[ Show Nearby Loci ]
Map Data
Barley, Abiotic QTL Consensus
Barley, Agronomic QTL Consensus
Barley, Consensus 2005, SNP
Barley, Steptoe x Morex, SNP
Probe
HVM22
ReferenceLiu Z-W et al. (1996) Development of simple sequence repeat DNA markers and their integration into a barley linkage map. Theoretical and Applied Genetics 93:869-876.
Reference
ReferenceRostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.



Probe
HVM22
Locus
HVM22
HVM022
HVM22b
HVM22a
Reference
ReferenceVarshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091.
ReferenceLiu Z-W et al. (1996) Development of simple sequence repeat DNA markers and their integration into a barley linkage map. Theoretical and Applied Genetics 93:869-876.
Remarks
Insert contains repeat (AC)13.
Type
PCR
SSR
PCR primers
5' TTTTGGGGGATGCCTACATA 3'
5' TTTCAAATGGTTGGATTGGA 3'
TTTTGGGGGATGCCTACATA
TTTCAAATGGTTGGATTGGA
SSR size
0.167
Amplification Conditions
The 'touchdown' PCR comprised 48 cycles of 94oC for 1 min denaturing and 72oC for 1 min extension. Annealing (30 s) temperatures were progressively decreased by 1oC every second cycle from 64oC to 55oC. Annealing conditions of 1 min at 55oC were maintained during the final 30 cycles. The reaction ended with a 5-min extension at 72oC.
Insert Enzyme
TaqI
Source Species
Hordeum vulgare
Source Germplasm
Old ZZ (barley)
DNA Origin
Size-fractionated genomic library screened with synthetic dinucleotide repeats (CA)10 and (GA)10.
Clone Vector
pGEM-7zf(+)
Vector Enzyme
ClaI
Data Source
Saghai Maroof, M.A.97.01.02



Locus for Probe
HVM022
Type
Microsatellite
Synonym
Other nameHVM22
Map
Hordeum-Bins-6H66.8
[ Show Nearby Loci ]
Map Data
Barley, BinMap 2005
Probe
HVM22



Locus for Probe
HVM22a
Type
Microsatellite
Chromosome
6H
Map
Hordeum-Consensus2007-SSR-6H62.14
Hv-Consensus2006-Marcel-6H62.14
Hv-Integrated2009-6H60.7
Hv-L94/Vada-2006-6H60.75
[ Show Nearby Loci ]
Map Data
Barley, Consensus 2006, Marcel
Barley, Consensus 2007, SSR
Barley, Integrated, Marcel 2009
Barley, L94 x Vada, 2006
Species
Hordeum vulgare
Probe
HVM22
Reference
ReferenceVarshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091.
ReferenceLiu Z-W et al. (1996) Development of simple sequence repeat DNA markers and their integration into a barley linkage map. Theoretical and Applied Genetics 93:869-876.
Remark
Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb'
[ Show all 6 ]



Locus for Probe
HVM22b
Type
Microsatellite
Chromosome
1H
Map
Hordeum-Consensus2007-SSR-1H71.88
Hv-Consensus2006-Marcel-1H71.88
Hv-Integrated2009-1H72.2
Hv-L94/Vada-2006-1H61.77
[ Show Nearby Loci ]
Map Data
Barley, Consensus 2006, Marcel
Barley, Consensus 2007, SSR
Barley, Integrated, Marcel 2009
Barley, L94 x Vada, 2006
Species
Hordeum vulgare
Probe
HVM22
Reference
ReferenceVarshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091.
ReferenceLiu Z-W et al. (1996) Development of simple sequence repeat DNA markers and their integration into a barley linkage map. Theoretical and Applied Genetics 93:869-876.
Remark
Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb'
[ Show all 6 ]