Query (optional)   in Class  

GrainGenes Marker Report: HVM31

[ Printable Version ]  [ Submit comment/correction ]

Locus
HVM31
Type
Microsatellite
Synonym
SynonymHVM31
Chromosome
6H
Map
Hordeum-Consensus2005-SNP-6H72.815
[ Show all 15 ]
[ Show Nearby Loci ]
Map Data
Barley, Abiotic QTL Consensus
[ Show all 15 ]
Species
Hordeum spontaneum
Hordeum vulgare
Hordeum vulgare subsp. spontaneum
Probe
HVM31
ReferenceLiu Z-W et al. (1996) Development of simple sequence repeat DNA markers and their integration into a barley linkage map. Theoretical and Applied Genetics 93:869-876.
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
ReferenceSzucs P et al. (2009) An Integrated Resource for Barley Linkage Map and Malting Quality QTL Alignment The Plant Genome 2:134-140.
ReferenceVarshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091.
ReferenceRostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
ReferenceLiu Z-W et al. (1996) Development of simple sequence repeat DNA markers and their integration into a barley linkage map. Theoretical and Applied Genetics 93:869-876.
Remark
Assigned to chromosome based on wheat-barley addition line assays.
[ Show all 8 ]



Probe
HVM31
Locus
HVM31
HVM31-6H
Reference
ReferenceVarshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091.
ReferenceLiu Z-W et al. (1996) Development of simple sequence repeat DNA markers and their integration into a barley linkage map. Theoretical and Applied Genetics 93:869-876.
Remarks
Insert contains repeat (AC)9.
Type
PCR
SSR
PCR primers
5' CGGTTTCTGGTTGCTTGG 3'
5' CGAAGGTCTCAGGCTTCATG 3'
CGGTTTCTGGTTGCTTGG
CGAAGCTCTCAGGCTTCATG
SSR size
0.163
Amplification Conditions
The 'touchdown' PCR comprised 48 cycles of 94oC for 1 min denaturing and 72oC for 1 min extension. Annealing (30 s) temperatures were progressively decreased by 1oC every second cycle from 64oC to 55oC. Annealing conditions of 1 min at 55oC were maintained during the final 30 cycles. The reaction ended with a 5-min extension at 72oC.
Insert Enzyme
TaqI
Source Species
Hordeum vulgare
Source Germplasm
Old ZZ (barley)
DNA Origin
Size-fractionated genomic library screened with synthetic dinucleotide repeats (CA)10 and (GA)10.
Clone Vector
pGEM-7zf(+)
Vector Enzyme
ClaI
Data Source
Saghai Maroof, M.A.97.01.02



Locus for Probe
HVM31-6H
Map
Hv-DxR-Stein-6H34.91
[ Show Nearby Loci ]
Map Data
Barley, OWB, Stein2006
Probe
HVM31