Query (optional)   in Class  

GrainGenes Marker Report: HVM4

[Submit comment/correction]

Locus
HVM4
Type
Microsatellite
Synonym
Correct nameHVM004
Chromosome
7H
Chromosome Arm
7HS
Map
Hordeum-Graner2-7H27.5
[ Show all 6 ]
[ Show Nearby Loci ]
QTL with Locus Marker
QHi.pil-7H.1
Map Data
Barley, AxHs/QTL
[ Show all 6 ]
Species
Hordeum vulgare
Hordeum vulgare subsp. spontaneum
Probe
HVM4
ReferenceLiu Z-W et al. (1996) Development of simple sequence repeat DNA markers and their integration into a barley linkage map. Theoretical and Applied Genetics 93:869-876.
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
ReferenceRostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.



Probe
HVM4
Locus
HVM4
HVM0004
HVM004
HVM04
Reference
ReferenceHearnden PR et al. (2007) A genetic map of 1,000 SSR and DArT markers in a wide barley cross. Theoretical and Applied Genetics 115:383-391.
ReferenceVarshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091.
ReferenceLiu Z-W et al. (1996) Development of simple sequence repeat DNA markers and their integration into a barley linkage map. Theoretical and Applied Genetics 93:869-876.
ReferenceSaghai Maroof MA et al. (1994) Extraordinarily polymorphic microsatellite DNA in barley: species diversity, chromosomal locations, and population dynamics. Proceedings of the National Academy of Sciences, USA 91:5466-5470.
Remarks
Insert contains repeat (AT)9.
Type
PCR
SSR
PCR primers
5' AGAGCAACTACCAGTCCAATGGCA 3'
5' GTCGAAGGAGAAGCGGCCCTGGTA 3'
AGAGCAACTACCAGTCCAATGGCA
GTCGAAGGAGAAGCGGCCCTGGTA
SSR size
0.198
Amplification Conditions
PCR comprised one cycle of 94oC for 3 min, 55oC for 2 min, and 72oC for 1.5 min, followed by 30 cycles of 94oC for 1 min, 55oC for 2 min, and 72oC for 1.5 min.
Sequence
X07931
Insert Enzyme
TaqI
Source Gene Class
Starch synthase
Source Species
Hordeum vulgare
Source Germplasm
Old ZZ (barley)
DNA Origin
Size-fractionated genomic library screened with synthetic dinucleotide repeats (CA)10 and (GA)10.
Clone Vector
pGEM-7zf(+)
Vector Enzyme
ClaI
Data Source
Saghai Maroof, M.A.97.01.02



Locus for Probe
HVM0004
Type
Microsatellite
Map
Barley, B73xCPI-7H19.2
[ Show Nearby Loci ]
Map Data
Barley, B73xCPI
Probe
HVM4



Locus for Probe
HVM004
Type
Microsatellite
Synonym
Other nameHVM4
Map
Hordeum-Bins-7H12
[ Show Nearby Loci ]
Map Data
Barley, BinMap 2005
Probe
HVM4
Data Source
Kleinhofs, Andris
Remark
This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin



Locus for Probe
HVM04
Type
Microsatellite
Chromosome
7H
Map
Hordeum-Consensus2007-SSR-7H22.19
Hv-Consensus2006-Marcel-7H22.19
Hv-Integrated2009-7H22.7
[ Show Nearby Loci ]
Map Data
Barley, Consensus 2006, Marcel
Barley, Consensus 2007, SSR
Barley, Integrated, Marcel 2009
Species
Hordeum vulgare
Probe
HVM4
Reference
ReferenceVarshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091.
ReferenceLiu Z-W et al. (1996) Development of simple sequence repeat DNA markers and their integration into a barley linkage map. Theoretical and Applied Genetics 93:869-876.
Remark
Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb'
[ Show all 6 ]

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.