Query (optional)   in Class  

GrainGenes Marker Report: HVM44

[ Printable Version ]  [ Submit comment/correction ]

Locus
HVM44
Type
Microsatellite
Synonym
Correct nameHVM044
SynonymHVM44
Chromosome
3H
Map
Hordeum-Consensus2005-SNP-3H49.273
[ Show all 9 ]
[ Show Nearby Loci ]
Map Data
Barley, Abiotic QTL Consensus
[ Show all 9 ]
Species
Hordeum spontaneum
Hordeum vulgare
Probe
HVM44
ReferenceLiu Z-W et al. (1996) Development of simple sequence repeat DNA markers and their integration into a barley linkage map. Theoretical and Applied Genetics 93:869-876.
Reference
ReferenceVarshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091.
ReferenceWenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206.
ReferenceRostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
ReferenceLi JZ et al. (2003) Development and genetic mapping of 127 new microsatellite markers in barley Theoretical and Applied Genetics 107:1021-1027.
Remark
Number of populations contributing to the placement of HVM44 in the Barley, Consensus 2006 DArT maps = 1
Locus in 'Barley, Consensus 2007, SSR' mapped in population(s) : Lina x H. spontaneum
Insert contains repeat (GA)8
Polymorphic Information Content (PIC) = 0.18
Developing laboratory = VPISU (MA Saghai Maroof)



Probe
HVM44
Locus
HVM44
HVM0044
HVM044
Reference
ReferenceHearnden PR et al. (2007) A genetic map of 1,000 SSR and DArT markers in a wide barley cross. Theoretical and Applied Genetics 115:383-391.
ReferenceVarshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091.
ReferenceLiu Z-W et al. (1996) Development of simple sequence repeat DNA markers and their integration into a barley linkage map. Theoretical and Applied Genetics 93:869-876.
Remarks
Insert contains repeat (GA)8.
Type
PCR
SSR
PCR primers
5' AAATCTCAGGTTCGTGGGCA 3'
5' CCACGGAGACCACCTCACTT 3'
AAATCTCAGGTTCGTGGGCA
CCACGGAGACCACCTCACTT
SSR size
0.114
Amplification Conditions
The 'touchdown' PCR comprised 48 cycles of 94oC for 1 min denaturing and 72oC for 1 min extension. Annealing (30 s) temperatures were progressively decreased by 1oC every second cycle from 64oC to 55oC. Annealing conditions of 1 min at 55oC were maintained during the final 30 cycles. The reaction ended with a 5-min extension at 72oC.
Insert Enzyme
TaqI
Source Species
Hordeum vulgare
Source Germplasm
Old ZZ (barley)
DNA Origin
Size-fractionated genomic library screened with synthetic dinucleotide repeats (CA)10 and (GA)10.
Clone Vector
pGEM-7zf(+)
Vector Enzyme
ClaI
Data Source
Saghai Maroof, M.A.97.01.02



Locus for Probe
HVM0044
Type
Microsatellite
Map
Barley, B73xCPI-3H46.1
[ Show Nearby Loci ]
Map Data
Barley, B73xCPI
Probe
HVM44



Locus for Probe
HVM044
Type
Microsatellite
Synonym
Other nameHVM44
Map
Hordeum-Bins-3H62.7
[ Show Nearby Loci ]
Map Data
Barley, BinMap 2005
Probe
HVM44