Query (optional)   in Class  

GrainGenes Marker Report: HvAMY2

[ Printable Version ]  [ Submit comment/correction ]

Locus
HvAMY2
Type
Microsatellite
Synonym
SynonymHvAMY2
Chromosome
7H
Map
Hordeum-Consensus2005-SNP-7H61.935
[ Show all 6 ]
[ Show Nearby Loci ]
Map Data
Barley, Abiotic QTL Consensus
[ Show all 6 ]
Species
Hordeum spontaneum
Hordeum vulgare
Probe
HvAMY2
Reference
ReferenceVarshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091.
ReferenceRostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
ReferenceRamsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remark
Locus in 'Barley, Consensus 2007, SSR' mapped in population(s) : Lina x H. spontaneum
Insert contains repeat (GCT)5
Developing laboratory = SCRI (R. Waugh)



Probe
HvAMY2
Locus
HvAMY2
Reference
ReferenceVarshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091.
ReferenceRamsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remarks
Insert contains repeat (GCT)5
Quality = 2: Single product, relatively strong stutter bands
Null in H. spontaneum Canada Park.
Type
PCR
SSR
PCR primers
5' CTGTAAGTGAGACAATCGACA 3'
5' CAGTTGAACCCCTGAAAG 3'
CTGTAAGTGAGACAATCGACA
CAGTTGAACCCCTGAAAG
SSR size
134
Amplification Conditions
1 cycle of 3 min @ 94C, 1 min @ 58C, 1 min @ 72C, 30 cycles of 30 secs @ 94C, 30 secs @ 58C, 30 secs @ 72C, 1 cycle of 5 mins @ 72C.
Sequence
M17128
Source Species
Hordeum vulgare