Query (optional)   in Class  

GrainGenes Marker Report: IWB48036

[ Printable Version ]  [ Submit comment/correction ]

Locus
IWB48036
Type
SNP
Synonym
Other nameBS00152560
Kukri_c855_2107
ReferenceWang S et al. (2014) Characterization of polyploid wheat genomic diversity using a high-density 90 000 single nucleotide polymorphism array. Plant Biotechnology Journal 12:787-796.
Chromosome Arm
7A
Map
Wheat, Yr genes and QTL 7A67.2
[ Show all 6 ]
[ Show Nearby Loci ]
Map Data
Wheat, Yr genes and QTL
[ Show all 6 ]
Species
Triticum aestivum
Probe
IWAB8036
Kukri_c855_2107
Reference
ReferenceBabiker EM et al. (2015) Mapping resistance to the Ug99 race group of the stem rust pathogen in a spring wheat landrace Theoretical and Applied Genetics 128:605-612.
ReferenceWang S et al. (2014) Characterization of polyploid wheat genomic diversity using a high-density 90 000 single nucleotide polymorphism array. Plant Biotechnology Journal 12:787-796.
ReferenceMAS Wheat. Bringing Genomics to the Wheat Fields. Disease resistance. Stem Rust Resistance. QSr.abr-7AL MAS Wheat. Marker Assisted Selection in Wheat.



Probe for Locus
IWAB8036
Locus
IWB48036
Reference
ReferenceBabiker EM et al. (2015) Mapping resistance to the Ug99 race group of the stem rust pathogen in a spring wheat landrace Theoretical and Applied Genetics 128:605-612.
ReferenceMAS Wheat. Bringing Genomics to the Wheat Fields. Disease resistance. Stem Rust Resistance. QSr.abr-7AL MAS Wheat. Marker Assisted Selection in Wheat.
PCR primers
F_ALA: 5' ATCTCGTTTCCATTCATCTTGTACTTATA F_ALG: 5' CTCGTTTCCATTCATCTTGTACTTATG
R: 5' AGCCAGTTGCTCCCACTCTATGTTT
Specificity
Forward primers are allele specific for SNPs A and G, respectively



Probe
Kukri_c855_2107
Locus
IWB48036
BS00152560
Kukri_c855_2107
Reference
ReferenceWang S et al. (2014) Characterization of polyploid wheat genomic diversity using a high-density 90 000 single nucleotide polymorphism array. Plant Biotechnology Journal 12:787-796.
Type
SNP
Sequence
Kukri_c855_2107



Locus for Probe
BS00152560
Synonym
Other nameIWB48036
Probe
Kukri_c855_2107



Locus for Probe
Kukri_c855_2107
Type
SNP
Map
Wheat-2018-NAM1-BxDharwarDry_7A181.4
[ Show all 12 ]
[ Show Nearby Loci ]
Map Data
Wheat-2018-NAM1-Berkut-x-DharwarDry
[ Show all 12 ]
Species
Triticum aestivum
Probe
Kukri_c855_2107