Query (optional)   in Class  

GrainGenes Marker Report: IWB5921

[Submit comment/correction]

Locus
IWB5921
Type
SNP
Synonym
Other nameBS00003914
BS00003914_51
ReferenceWang S et al. (2014) Characterization of polyploid wheat genomic diversity using a high-density 90 000 single nucleotide polymorphism array. Plant Biotechnology Journal 12:787-796.
Chromosome Arm
4A
Map
Wheat, Yr genes and QTL 4A4.5
Wheat_2014_90KSNP_4A22.4656
Wheat_Yr_2021-4A9.64
[ Show Nearby Loci ]
Map Data
Wheat, Yr genes and QTL
Wheat, Yr Update, 2021
Wheat_2014_90KSNP
Species
Triticum aestivum
Probe
BS00003914_51
Reference
ReferenceWang S et al. (2014) Characterization of polyploid wheat genomic diversity using a high-density 90 000 single nucleotide polymorphism array. Plant Biotechnology Journal 12:787-796.



Probe
BS00003914_51
Locus
IWB5921
BS00003914
BS00003914_51
Reference
ReferenceWang S et al. (2014) Characterization of polyploid wheat genomic diversity using a high-density 90 000 single nucleotide polymorphism array. Plant Biotechnology Journal 12:787-796.
ReferenceAllen AM et al. (2011) Transcipt-specific, single-nucleotide polymorphism discovery and linkage analysis in hexaploid bread wheat (Triticum aestivum L.) Plant Biotechnology Journal 9:1086-1099.
Type
SNP
KASP
PCR primers
FAM 5' CCTCGAGGTCCCAGTTTCTTGAA 3'
Common 5' CTTTACAAAAGCAGGATTTAGCGACTATAA 3'
VIC 5' CTCGAGGTCCCAGTTTCTTGAC 3'
Common 5' CTTTACAAAAGCAGGATTTAGCGACTATAA 3'
Specificity
FAM primer specific to A allele, and VIC primer specific to C allele.
Sequence
BS00003914_51



Locus for Probe
BS00003914
Type
SNP
Synonym
Other nameIWB5921
Map
Wheat, Avalon x Cadenza 4A10
Wheat_2017_LRC-4A0
[ Show Nearby Loci ]
Map Data
Wheat, Avalon x Cadenza
Wheat_2017_LRC
Probe
BS00003914_51



Locus for Probe
BS00003914_51
Type
SNP
Map
Wheat-2018-NAM1-BxDharwarDry_4A6.6
Wheat-2018-NAM14-BxPI70613_4A16.6
Wheat-2018-NAM24-BxPI192147_4A10.7
[ Show Nearby Loci ]
Map Data
Wheat-2018-NAM1-Berkut-x-DharwarDry
Wheat-2018-NAM14-Berkut-x-PI70613
Wheat-2018-NAM24-Berkut-x-PI192147
Species
Triticum aestivum
Probe
BS00003914_51

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.