Query (optional)   in Class  

GrainGenes Marker Report: IWB6535

[Submit comment/correction]

Locus
IWB6535
Type
SNP
Synonym
Other nameBS00012150
BS00012150_51
ReferenceWang S et al. (2014) Characterization of polyploid wheat genomic diversity using a high-density 90 000 single nucleotide polymorphism array. Plant Biotechnology Journal 12:787-796.
Chromosome Arm
6A
Map
Wheat, Yr genes and QTL 6A6.5
[ Show all 9 ]
[ Show Nearby Loci ]
Map Data
Wheat, Yr genes and QTL
[ Show all 9 ]
Species
Triticum aestivum
Probe
BS00012150_51
Reference
ReferenceWang S et al. (2014) Characterization of polyploid wheat genomic diversity using a high-density 90 000 single nucleotide polymorphism array. Plant Biotechnology Journal 12:787-796.



Probe
BS00012150_51
Locus
IWB6535
BS00012150
BS00012150_51
Reference
ReferenceWang S et al. (2014) Characterization of polyploid wheat genomic diversity using a high-density 90 000 single nucleotide polymorphism array. Plant Biotechnology Journal 12:787-796.
ReferenceAllen AM et al. (2011) Transcipt-specific, single-nucleotide polymorphism discovery and linkage analysis in hexaploid bread wheat (Triticum aestivum L.) Plant Biotechnology Journal 9:1086-1099.
Type
SNP
KASP
PCR primers
FAM 5' ATGTGCACCTGATTGACAGCGT 3'
Common 5' AGGCGTATGCTGTCGTCCCCAT 3'
VIC 5' ATGTGCACCTGATTGACAGCGC 3'
Common 5' AGGCGTATGCTGTCGTCCCCAT 3'
Specificity
FAM primer specific to A allele, and VIC primer specific to G allele.
Sequence
BS00012150_51



Locus for Probe
BS00012150
Type
SNP
Synonym
Other nameIWB6535
Map
Wheat, Avalon x Cadenza 6A22
Wheat_2017_LRC-6A12.2
[ Show Nearby Loci ]
Map Data
Wheat, Avalon x Cadenza
Wheat_2017_LRC
Probe
BS00012150_51



Locus for Probe
BS00012150_51
Type
SNP
Map
Wheat-2018-NAM15-BxCItr7635_6A4.1
Wheat-2018-NAM8-BxPBW343_6A6.7
[ Show Nearby Loci ]
Map Data
Wheat-2018-NAM15-Berkut-x-CItr7635
Wheat-2018-NAM8-Berkut-x-PBW343
Species
Triticum aestivum
Probe
BS00012150_51

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.