Query (optional)   in Class  

GrainGenes Marker Report: MWG2031

[ Printable Version ]  [ Submit comment/correction ]

Locus
MWG2031
Type
RFLP
STS
Chromosome
7H
Chromosome Arm
7HL
7HS
Map
Barley-Consensus-7H-2.8
[ Show all 12 ]
[ Show Nearby Loci ]
QTL with Locus Marker
QDp.HaMo-7H
[ Show all 9 ]
Map Data
Barley consensus
[ Show all 12 ]
Species
Hordeum vulgare
Hordeum vulgare subsp. spontaneum
Probe
MWG2031
Reference
ReferenceSato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
ReferenceSzucs P et al. (2009) An Integrated Resource for Barley Linkage Map and Malting Quality QTL Alignment The Plant Genome 2:134-140.
ReferenceWenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206.
Data Source
Kleinhofs, Andris
Remark
Number of populations contributing to the placement of MWG2031 in the Barley, Consensus 2006 DArT maps = 1
This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin
Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb'
Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Oregon Wolfe Barleys,Igri x Franka
Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Igri x Franka
Possible Orthologs
MWG2031-7H
Xmwg2031



Probe
MWG2031
Locus
MWG2031
Xmwg2031
MWG2031-7H
Type
Genomic
STS
STS primers
5' AACGCTCTGTGTTTCCAGACC
5' TGCAGTATGAGTTGCCAGC
STS size
ca. 1200
Amplification Conditions
STS annealing temperature 58-60 oC
Sequence
AJ234722
AJ234721
MWG2031
MWG2031-5
MWG2031-3
Insert Enzyme
PstI
Source Species
Hordeum vulgare
Clone Vector
Bluescript
Excision Enzyme
PstI
Clone Location
Graner, Andreas
Clone Authority
Graner, Andreas
Data Source
Graner, Andreas94.03.08
Kuenzel, Gottfried00.03



Locus for Probe
MWG2031-7H
Type
RFLP
Map
Hv-IxF-Stein-7H109.79
[ Show Nearby Loci ]
Map Data
Barley, IxF, Stein2006
Probe
MWG2031
Possible Orthologs
MWG2031
Xmwg2031



Locus for Probe
Xmwg2031
Type
RFLP
Chromosome
7D
Chromosome Arm
7DL
Map
Ta-Physical-Gill-7ABD47
Tm-Dubcovsky2-7A2.1
[ Show Nearby Loci ]
Breakpoint Interval
7L-0.45-0.49
Map Data
T. monococcum, DV92 x G3116
Wheat, Physical
Species
Triticum aestivum
Probe
MWG2031
Reference
ReferenceBoyko EV et al. (1999) A high-density genetic linkage map of Aegilops tauschii, the D-genome progenitor of bread wheat. Theoretical and Applied Genetics 99:16-26.
Possible Orthologs
MWG2031
MWG2031-7H