Query (optional)   in Class  

GrainGenes Marker Report: MWG2135

[ Printable Version ]  [ Submit comment/correction ]

Locus
MWG2135
Type
RFLP
Chromosome
4H
Chromosome Arm
4HL
Map
Barley-Consensus-4H7
[ Show all 8 ]
[ Show Nearby Loci ]
Map Data
Barley consensus
[ Show all 8 ]
Probe
MWG2135
Reference
ReferenceWenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206.
Data Source
Kleinhofs, Andris
Remark
Number of populations contributing to the placement of MWG2135 in the Barley, Consensus 2006 DArT maps = 1
This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin
Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb'
Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Igri x Franka
Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Igri x Franka



Probe
MWG2135
Locus
MWG2135
Synonym
SynonymHAR35_19261
Type
Genomic
STS
STS primers
5' GAAGACAAGCAGCAGCGACG
5' CAGGTATGCTTCGTGATCGCG
STS size
ca. 700
Amplification Conditions
STS annealing temperature 58-60 oC
Sequence
AJ234796
AJ234795
MWG2135-5
MWG2135-3
Insert Enzyme
PstI
Source Species
Hordeum vulgare
Clone Vector
Bluescript
Excision Enzyme
PstI
Clone Location
Graner, Andreas
Clone Authority
Graner, Andreas
Data Source
Graner, Andreas94.03.08
Kuenzel, Gottfried00.03