Query (optional)   in Class  

GrainGenes Marker Report: MWG2138

[ Printable Version ]  [ Submit comment/correction ]

Locus
MWG2138
Type
RFLP
Chromosome
3H
Chromosome Arm
3HL
Map
Barley-Consensus-3H2.8
[ Show all 7 ]
[ Show Nearby Loci ]
Map Data
Barley consensus
[ Show all 7 ]
Probe
MWG2138
Data Source
Kleinhofs, Andris
Remark
This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin
Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb'
Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Igri x Franka
Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Igri x Franka
Possible Orthologs
Xmwg2138-3



Probe
MWG2138
Locus
Xmwg2138-3
[ Show all 6 ]
Type
Genomic
STS
STS primers
5' CGAGGCTGTGCGGCACGAAG
5' GGTCTGCCCCGTCTGGATCG
STS size
379
Amplification Conditions
STS annealing temperature 65-67 oC
Sequence
AJ234800
AJ234799
MWG2138-5
MWG2138-3
Insert Enzyme
PstI
Source Species
Hordeum vulgare
Clone Vector
Bluescript
Excision Enzyme
PstI
Clone Location
Graner, Andreas
Clone Authority
Graner, Andreas
Data Source
Graner, Andreas94.03.08
Kuenzel, Gottfried00.03



Locus for Probe
HD006N14
Probe
MWG2138



Locus for Probe
HD091E16
Probe
MWG2138



Locus for Probe
HI065K14
Probe
MWG2138



Locus for Probe
HI091K17
Probe
MWG2138



Locus for Probe
Xmwg2138-3
Type
RFLP
Map
Triticeae-Sorrells-3-update53.3
[ Show Nearby Loci ]
Map Data
Triticeae consensus
Probe
MWG2138
Possible Orthologs
MWG2138