Query (optional)   in Class  

GrainGenes Marker Report: MWG2266

[ Printable Version ]  [ Submit comment/correction ]

Locus
MWG2266
Type
RFLP
Chromosome
3H
Map
Hordeum-Bins-3H39
Hordeum-Graner2-3H38.2
Hv-Consensus2006-Marcel-3H26.32
Hv-Integrated2009-3H38.6
[ Show Nearby Loci ]
Map Data
Barley, BinMap 2005
Barley, Consensus 2006, Marcel
Barley, Integrated, Marcel 2009
Barley, IxF
Probe
MWG2266
Data Source
Kleinhofs, Andris
Remark
This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin
Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb'
Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Igri x Franka
Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Igri x Franka
Possible Orthologs
MWG2266-3H



Probe
MWG2266
Locus
MWG2266
MWG2266-3H
Synonym
SynonymHAR35_3067
STS primers
5' GTCACCAGTTGTGTAAGGTGG
5' AACAGGAGGTTGTTCAGCAGC
STS size
377
Amplification Conditions
STS annealing temperature 60-62 oC
Sequence
AJ234871
MWG2266-5
Data Source
Kuenzel, Gottfried00.03



Locus for Probe
MWG2266-3H
Type
RFLP
Map
Hv-IxF-Stein-3H0
[ Show Nearby Loci ]
Map Data
Barley, IxF, Stein2006
Probe
MWG2266
Possible Orthologs
MWG2266