Query (optional)   in Class  

GrainGenes Marker Report: MWG2266-3H

[ Printable Version ]  [ Submit comment/correction ]

Locus
MWG2266-3H
Type
RFLP
Map
Hv-IxF-Stein-3H0
[ Show Nearby Loci ]
Map Data
Barley, IxF, Stein2006
Probe
MWG2266
Possible Orthologs
MWG2266



Probe for Locus
MWG2266
Locus
MWG2266
MWG2266-3H
Synonym
SynonymHAR35_3067
STS primers
5' GTCACCAGTTGTGTAAGGTGG
5' AACAGGAGGTTGTTCAGCAGC
STS size
377
Amplification Conditions
STS annealing temperature 60-62 oC
Sequence
AJ234871
MWG2266-5
Data Source
Kuenzel, Gottfried00.03