Query (optional)   in Class  

GrainGenes Marker Report: MWG514

[ Printable Version ]  [ Submit comment/correction ]

Locus
MWG514
Type
RFLP
Synonym
SynonymMWG514B
Chromosome
5H
6H
Chromosome Arm
6HL
Map
Barley-consensus-2003-5H31.4
[ Show all 11 ]
[ Show Nearby Loci ]
QTL with Locus Marker
QHd.IgTr-6H.2
QHt.IgDa-6H
QScd.IgDa-6H.2
Map Data
Barley consensus
[ Show all 11 ]
Species
Hordeum vulgare
Probe
MWG514
Reference
ReferenceSzucs P et al. (2009) An Integrated Resource for Barley Linkage Map and Malting Quality QTL Alignment The Plant Genome 2:134-140.
ReferenceMesfin A et al. (2003) Quantitative trait loci for fusarium head blight resistance in barley detected in a two-rowed by six-rowed population Crop Science 43:307-318.
Data Source
Kleinhofs, Andris
Langridge, Peter J.
Remark
This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin
Possible Orthologs
MWG514A
MWG514B
MWG514b-5H
Xmwg514
Xmwg514-3R



Probe
MWG514
Locus
MWG514
[ Show all 6 ]
Reference
ReferenceGraner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256.
Type
Genomic
STS
STS primers
5' GTGCATTAATACAGTGCCCA
5' CACAAACGTTACGAGTACAG
STS size
472
Amplification Conditions
STS annealing temperature 50-52 oC
Sequence
AJ234478
AJ234477
MWG514-5
MWG514-3
Linkage Group
5H
Insert Enzyme
PstI
Source Species
Hordeum vulgare
Insert Size
1
Clone Vector
Bluescript
pBluescr.
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Graner, Andreas
Clone Authority
Graner, Andreas
Data Source
Graner, Andreas94.03.08
ATMI92.09
Kuenzel, Gottfried00.03



Locus for Probe
MWG514A
Type
RFLP
Chromosome
6H
Map
Hv-Consensus2006-Marcel-6H139.9
Hv-Integrated2009-6H132.2
[ Show Nearby Loci ]
Map Data
Barley, Consensus 2006, Marcel
Barley, Integrated, Marcel 2009
Probe
MWG514
Remark
Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb'
Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Oregon Wolfe Barleys,Igri x Franka
Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Igri x Franka
Possible Orthologs
MWG514
MWG514B
MWG514b-5H
Xmwg514
Xmwg514-3R



Locus for Probe
MWG514B
Type
RFLP
Synonym
SynonymMWG514
Chromosome
5H
Map
Barley-Consensus2-5H133.7
[ Show all 17 ]
[ Show Nearby Loci ]
In QTL
QSss.StMo-5H.1
Map Data
Barley consensus 2
[ Show all 17 ]
Species
Hordeum vulgare
Probe
MWG514
Reference
ReferenceClose TJ et al. (2009) Development and implementation of high-throughput SNP genotyping in barley. BMC Genomics 10:582.
[ Show all 6 ]
Data Source
Blake, Tom05.04.19
Close, Timothy J.
Remark
Number of populations contributing to the placement of MWG514B in the Barley, Consensus 2006 DArT maps = 1
Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb'
Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex
Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex
Locus in 'Barley, Consensus 2007, SSR' was a BIN marker in 'Barley, Consensus 2006, Marcel'
Possible Orthologs
MWG514
MWG514A
MWG514b-5H
Xmwg514
Xmwg514-3R



Locus for Probe
MWG514b-5H
Type
RFLP
Map
Hv-SxM-Stein-5H105.35
[ Show Nearby Loci ]
Map Data
Barley, SxM, Stein2006
Probe
MWG514
Possible Orthologs
MWG514
MWG514A
MWG514B
Xmwg514
Xmwg514-3R



Locus for Probe
Xmwg514
Type
RFLP
Chromosome
3R
5A
Chromosome Arm
3RL
Map
Hordeum-IxT/Q-6H120.9
Secale-PxP-update-3R118.8
Wheat-Composite2004-5A61
[ Show Nearby Loci ]
In QTL
eps6L.2 autumn
eps6L.2 spring
Map Data
Barley, IxT/QTL
Rye, P87 x P105, update
Wheat, Composite, 2004
Probe
MWG514
Possible Orthologs
MWG514
MWG514A
MWG514B
MWG514b-5H
Xmwg514-3R



Locus for Probe
Xmwg514-3R
Type
RFLP
Chromosome
3R
Map
Secale-PxP-2004-3R123.5
[ Show Nearby Loci ]
Map Data
Rye, P87 x P105, 2004
Species
Secale cereale
Probe
MWG514
Reference
ReferenceKhlestkina EK et al. (2004) Mapping of 99 new microsatellite-derived loci in rye (Secale cereale L.) including 39 expressed sequence tags Theoretical and Applied Genetics 109:725-732.
Possible Orthologs
MWG514
MWG514A
MWG514B
MWG514b-5H
Xmwg514