Query (optional)   in Class  

GrainGenes Marker Report: MWG573(HT)

[ Printable Version ]  [ Submit comment/correction ]

Locus
MWG573(HT)
Type
RFLP
Map
Barley-Consensus2-7H70.7
[ Show Nearby Loci ]
Map Data
Barley consensus 2
Probe
MWG573
Possible Orthologs
MWG573
[ Show all 11 ]



Probe for Locus
MWG573
Locus
MWG573
[ Show all 12 ]
Synonym
SynonymHAR35_18027
HAR35_50874
Type
Genomic
STS
STS primers
5' CTGCACTCATGTCAGCAAGA
5' GACCAACGGGAGATGCTCGT
STS size
240
Amplification Conditions
STS annealing temperature 58-60 oC
Sequence
AJ234515
AJ234514
MWG573-5
MWG573-3
Insert Enzyme
PstI
Source Species
Hordeum vulgare
Clone Vector
Bluescript
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Graner, Andreas
Clone Authority
Graner, Andreas
Data Source
Graner, Andreas94.03.08
Kuenzel, Gottfried00.03