Query (optional)   in Class  

GrainGenes Marker Report: MWG635

[ Printable Version ]  [ Submit comment/correction ]

Locus
MWG635
Type
RFLP
Synonym
SynonymMWG635a
MWG635b
MWG635C
QTL with Locus Marker
QHd.IgDa-7H.1
QScd.IgDa-7H
QYld.IgDa-7H
Probe
MWG635
Possible Orthologs
MWG635a
[ Show all 7 ]



Probe
MWG635
Locus
MWG635C
[ Show all 10 ]
Synonym
SynonymHAR35_27222
HAR35_27940
Reference
ReferenceGraner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256.
Type
Genomic
STS
STS primers
5' ACCGACGCAGACCTTCAG
5' TCAAGACCATGAAGCACGAG
STS size
178
Amplification Conditions
STS annealing temperature 58-60 oC
Sequence
AJ234550
MWG635-5
MWG635-3
Insert Enzyme
PstI
Source Species
Hordeum vulgare
Clone Vector
Bluescript
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Graner, Andreas
Clone Authority
Graner, Andreas
Data Source
Graner, Andreas94.03.08
Kuenzel, Gottfried00.03



Locus for Probe
MWG635a
Type
RFLP
Synonym
SynonymMWG635
Chromosome
4H
Map
Barley-Consensus2-4H37.5
[ Show all 18 ]
[ Show Nearby Loci ]
Map Data
Barley consensus 2
[ Show all 18 ]
Probe
MWG635
Reference
ReferenceWenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206.
ReferenceRodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184.
ReferenceRostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
ReferenceLi JZ et al. (2003) Development and genetic mapping of 127 new microsatellite markers in barley Theoretical and Applied Genetics 107:1021-1027.
Data Source
Blake, Tom05.04.19
Remark
Number of populations contributing to the placement of MWG635A in the Barley, Consensus 2006 DArT maps = 1
Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb'
Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex,Igri x Franka
Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex; Igri x Franka
Possible Orthologs
MWG635
[ Show all 7 ]



Locus for Probe
MWG635A(HT)
Type
RFLP
Map
Barley-Consensus2-5H51.7
[ Show Nearby Loci ]
Map Data
Barley consensus 2
Probe
MWG635
Possible Orthologs
MWG635
[ Show all 7 ]



Locus for Probe
MWG635a-4H
Type
RFLP
Map
Hv-IxF-Stein-4H44.17
Hv-SxM-Stein-4H40.34
[ Show Nearby Loci ]
Map Data
Barley, IxF, Stein2006
Barley, SxM, Stein2006
Probe
MWG635
Possible Orthologs
MWG635
[ Show all 7 ]



Locus for Probe
MWG635b
Type
RFLP
Synonym
SynonymMWG635
Chromosome
1H
5H
7H
Map
Barley-Consensus2-7H143.1
[ Show all 17 ]
[ Show Nearby Loci ]
In QTL
QHD.umn-5H.1
Map Data
Barley consensus 2
[ Show all 17 ]
Probe
MWG635
Reference
ReferenceWenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206.
ReferenceRodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184.
ReferenceRostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
ReferenceMesfin A et al. (2003) Quantitative trait loci for fusarium head blight resistance in barley detected in a two-rowed by six-rowed population Crop Science 43:307-318.
Data Source
Blake, Tom05.04.19
Remark
Number of populations contributing to the placement of MWG635B in the Barley, Consensus 2006 DArT maps = 1
Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb'
Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex
Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex
Possible Orthologs
MWG635
[ Show all 7 ]



Locus for Probe
MWG635C
Type
RFLP
Synonym
SynonymMWG635
Chromosome
1H
Map
Barley-Consensus2-1H139.9
[ Show all 11 ]
[ Show Nearby Loci ]
Map Data
Barley consensus 2
[ Show all 11 ]
Probe
MWG635
Reference
ReferenceRostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Data Source
Blake, Tom05.04.19
Remark
Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb'
Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex
Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex
Possible Orthologs
MWG635
[ Show all 7 ]



Locus for Probe
MWG635d
Type
RFLP
Chromosome
5H
Chromosome Arm
5HS
Map
Hordeum-HxM-base-5H5.9
[ Show Nearby Loci ]
In QTL
QGpc.HaMo-5H
[ Show all 10 ]
Map Data
Barley, HxM/QTL
Probe
MWG635
Possible Orthologs
MWG635
[ Show all 7 ]



Locus for Probe
RI002M19
Probe
MWG635



Locus for Probe
RI003O16
Probe
BCD1434
MWG635
Homology
S40414e-value: 2.1chitinase (EC 3.2.1.14) - rice
T14812e-value: 8e-17hypothetical protein F15J5.90 - Arabidopsis thaliana



Locus for Probe
Xmwg635
Type
RFLP
Map
Tm-Dubcovsky2-4A-8.9
[ Show Nearby Loci ]
Map Data
T. monococcum, DV92 x G3116
Probe
MWG635
Possible Orthologs
MWG635
[ Show all 7 ]