Query (optional)   in Class  

GrainGenes Marker Report: MWG635a

[ Printable Version ]  [ Submit comment/correction ]

Locus
MWG635a
Type
RFLP
Synonym
SynonymMWG635
Chromosome
4H
Map
Barley-Consensus2-4H37.5
[ Show all 18 ]
[ Show Nearby Loci ]
Map Data
Barley consensus 2
[ Show all 18 ]
Probe
MWG635
Reference
ReferenceWenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206.
ReferenceRodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184.
ReferenceRostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
ReferenceLi JZ et al. (2003) Development and genetic mapping of 127 new microsatellite markers in barley Theoretical and Applied Genetics 107:1021-1027.
Data Source
Blake, Tom05.04.19
Remark
Number of populations contributing to the placement of MWG635A in the Barley, Consensus 2006 DArT maps = 1
Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb'
Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex,Igri x Franka
Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex; Igri x Franka
Possible Orthologs
MWG635
[ Show all 7 ]



Probe for Locus
MWG635
Locus
MWG635C
[ Show all 10 ]
Synonym
SynonymHAR35_27222
HAR35_27940
Reference
ReferenceGraner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256.
Type
Genomic
STS
STS primers
5' ACCGACGCAGACCTTCAG
5' TCAAGACCATGAAGCACGAG
STS size
178
Amplification Conditions
STS annealing temperature 58-60 oC
Sequence
AJ234550
MWG635-5
MWG635-3
Insert Enzyme
PstI
Source Species
Hordeum vulgare
Clone Vector
Bluescript
Excision Enzyme
PstI
Clone Location
GrainGenes Probe Repository
Graner, Andreas
Clone Authority
Graner, Andreas
Data Source
Graner, Andreas94.03.08
Kuenzel, Gottfried00.03