Query (optional)   in Class  

GrainGenes Marker Report: MWG798A

[ Printable Version ]  [ Submit comment/correction ]

Locus
MWG798A
Type
RFLP
Synonym
SynonymMWG798
Chromosome
6H
Map
Barley-Consensus2-6H139.6
[ Show all 21 ]
[ Show Nearby Loci ]
Map Data
Barley consensus 2
[ Show all 21 ]
Species
Hordeum vulgare
Probe
MWG798
Reference
ReferenceSzucs P et al. (2009) An Integrated Resource for Barley Linkage Map and Malting Quality QTL Alignment The Plant Genome 2:134-140.
[ Show all 6 ]
Data Source
Blake, Tom05.04.19
Close, Timothy J.
Remark
Number of populations contributing to the placement of MWG798A in the Barley, Consensus 2006 DArT maps = 2
Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb'
Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex,Oregon Wolfe Barleys,Igri x Franka
Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex; Igri x Franka
Possible Orthologs
MWG798
[ Show all 7 ]



Probe for Locus
MWG798
Locus
MWG798A
[ Show all 8 ]
Reference
ReferenceGraner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256.
Type
Genomic
STS
STS primers
5' GGCTGTCTACATCTTCTGCA
5' CAAGTGTTGAGAAGGAGAGT
STS size
365
Amplification Conditions
STS annealing temperature 55-58 oC
Sequence
AJ234554
AJ234553
MWG798-5
MWG798-3
Insert Enzyme
PstI
Source Species
Hordeum vulgare
Clone Vector
Bluescript
Excision Enzyme
PstI
Clone Location
Graner, Andreas
Clone Authority
Graner, Andreas
Data Source
Graner, Andreas94.03.08
Kuenzel, Gottfried00.03