Query (optional)   in Class  

GrainGenes Marker Report: MWG800

[ Printable Version ]  [ Submit comment/correction ]

Locus
MWG800
Type
RFLP
Synonym
SynonymMWG800
POPA2_1333
Chromosome
1H
Chromosome Arm
1HL
Map
Barley-Consensus-1H16.8
[ Show all 12 ]
[ Show Nearby Loci ]
Map Data
Barley consensus
[ Show all 14 ]
Probe
MWG800
Reference
ReferenceRostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Remark
Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb'
Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex,Igri x Franka
Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex; Igri x Franka
Possible Orthologs
MWG800-1H
Xmwg800-1



Probe
MWG800
Locus
MWG800
Xmwg800-1
MWG800-1H
Synonym
SynonymHAR35_3315
HAR35_5111
Type
Genomic
STS
STS primers
5' GTCCGTAACCTGTGGTACTG
5' GCAGCTAAGTTGGCTAGAGC
STS size
400
Amplification Conditions
STS annealing temperature 55-58 oC
Sequence
AJ234557
MWG800-5
Linkage Group
1H
Insert Enzyme
PstI
Source Species
Hordeum vulgare
Insert Size
0.8
Clone Vector
Bluescript
pBluescr.
Excision Enzyme
PstI
Clone Location
Graner, Andreas
Clone Authority
Graner, Andreas
Data Source
Graner, Andreas94.03.08
ATMI92.09
Kuenzel, Gottfried00.03



Locus for Probe
MWG800-1H
Type
RFLP
Map
Hv-IxF-Stein-1H52.03
Hv-SxM-Stein-1H55.31
[ Show Nearby Loci ]
Map Data
Barley, IxF, Stein2006
Barley, SxM, Stein2006
Probe
MWG800
Possible Orthologs
MWG800
Xmwg800-1



Locus for Probe
Xmwg800-1
Type
RFLP
Chromosome Arm
1L
Map
Triticeae-Sorrells-153.9
[ Show Nearby Loci ]
Map Data
Triticeae consensus
Probe
MWG800
Possible Orthologs
MWG800
MWG800-1H