Query (optional)   in Class  

GrainGenes Marker Report: MWG813

[ Printable Version ]  [ Submit comment/correction ]

Locus
MWG813
Type
RFLP
Synonym
SynonymMWG813a
MWG813B
POPA2_0403
Map
Hordeum-Graner1-5H305.5
Hordeum-NABGMP2-5H242.8
[ Show Nearby Loci ]
Map Data
Barley, HxT
Barley, VxHs
Probe
MWG813
Possible Orthologs
MWG813a
[ Show all 7 ]



Probe
MWG813
Locus
MWG813a
[ Show all 8 ]
Synonym
SynonymHAR35_15734
HAR35_2555
HAR35_2556
Reference
ReferenceGraner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256.
Type
Genomic
STS
STS primers
5' TTGGACAGGATGTTGCCA
5' CATTCAGTAACACCGCCATG
STS size
115
Amplification Conditions
STS annealing temperature 55-58 oC
Sequence
AJ234569
AJ234568
MWG813-5
MWG813-3
Insert Enzyme
PstI
Source Species
Hordeum vulgare
Clone Vector
Bluescript
Excision Enzyme
PstI
Clone Location
Graner, Andreas
Clone Authority
Graner, Andreas
Data Source
Graner, Andreas94.03.08
Kuenzel, Gottfried00.03



Locus for Probe
MWG813a
Type
RFLP
Synonym
SynonymMWG813
Chromosome
5H
Map
Barley-Consensus2-5H187.8
[ Show all 11 ]
[ Show Nearby Loci ]
Map Data
Barley consensus 2
[ Show all 11 ]
Probe
MWG813
Reference
ReferenceRostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
ReferenceLi JZ et al. (2003) Development and genetic mapping of 127 new microsatellite markers in barley Theoretical and Applied Genetics 107:1021-1027.
Data Source
Blake, Tom05.04.19
Remark
Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb'
Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex,Igri x Franka
Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex; Igri x Franka
Possible Orthologs
MWG813
[ Show all 7 ]



Locus for Probe
MWG813a-5H
Type
RFLP
Map
Hv-IxF-Stein-5H187.07
Hv-SxM-Stein-5H146.75
[ Show Nearby Loci ]
Map Data
Barley, IxF, Stein2006
Barley, SxM, Stein2006
Probe
MWG813
Possible Orthologs
MWG813
[ Show all 7 ]



Locus for Probe
MWG813Aa
Type
RFLP
Chromosome
5H
Map
Hordeum-StMo-SNP-5H174.71
[ Show Nearby Loci ]
Map Data
Barley, Steptoe x Morex, SNP
Probe
MWG813
Reference
ReferenceRostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Possible Orthologs
MWG813
[ Show all 7 ]



Locus for Probe
MWG813B
Type
RFLP
Synonym
SynonymMWG813
Chromosome
7H
Map
Barley-Consensus2-7H76.2
[ Show all 8 ]
[ Show Nearby Loci ]
Map Data
Barley consensus 2
[ Show all 10 ]
Probe
MWG813
Reference
ReferenceRostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Remark
Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb'
Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex
Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex
Possible Orthologs
MWG813
[ Show all 7 ]



Locus for Probe
Xmwg813-3A
Type
RFLP
Map
Tm-Dubcovsky2-3A-28.9
[ Show Nearby Loci ]
Map Data
T. monococcum, DV92 x G3116
Probe
MWG813
Possible Orthologs
MWG813
[ Show all 7 ]



Locus for Probe
Xmwg813-4A
Type
RFLP
Map
Tm-Dubcovsky2-4A52.3
[ Show Nearby Loci ]
Map Data
T. monococcum, DV92 x G3116
Probe
MWG813
Possible Orthologs
MWG813
[ Show all 7 ]



Locus for Probe
Xmwg813-6A
Type
RFLP
Map
Tm-Dubcovsky2-6A30.7
[ Show Nearby Loci ]
Map Data
T. monococcum, DV92 x G3116
Probe
MWG813
Possible Orthologs
MWG813
[ Show all 7 ]