Query (optional)   in Class  

GrainGenes Marker Report: MWG813B

[ Printable Version ]  [ Submit comment/correction ]

Locus
MWG813B
Type
RFLP
Synonym
SynonymMWG813
Chromosome
7H
Map
Barley-Consensus2-7H76.2
[ Show all 8 ]
[ Show Nearby Loci ]
Map Data
Barley consensus 2
[ Show all 10 ]
Probe
MWG813
Reference
ReferenceRostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Remark
Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb'
Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex
Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex
Possible Orthologs
MWG813
[ Show all 7 ]



Probe for Locus
MWG813
Locus
MWG813a
[ Show all 8 ]
Synonym
SynonymHAR35_15734
HAR35_2555
HAR35_2556
Reference
ReferenceGraner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256.
Type
Genomic
STS
STS primers
5' TTGGACAGGATGTTGCCA
5' CATTCAGTAACACCGCCATG
STS size
115
Amplification Conditions
STS annealing temperature 55-58 oC
Sequence
AJ234569
AJ234568
MWG813-5
MWG813-3
Insert Enzyme
PstI
Source Species
Hordeum vulgare
Clone Vector
Bluescript
Excision Enzyme
PstI
Clone Location
Graner, Andreas
Clone Authority
Graner, Andreas
Data Source
Graner, Andreas94.03.08
Kuenzel, Gottfried00.03