Query (optional)   in Class  

GrainGenes Marker Report: MWG847

[ Printable Version ]  [ Submit comment/correction ]

Locus
MWG847
Type
RFLP
Chromosome
3H
Chromosome Arm
3HL
Map
Barley-Consensus-3H48.8
[ Show all 10 ]
[ Show Nearby Loci ]
QTL with Locus Marker
QBgnm.HaTR-3H.2
Map Data
Barley consensus
[ Show all 10 ]
Species
Hordeum vulgare
Probe
MWG847
Reference
ReferenceVarshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091.
Data Source
Kleinhofs, Andris
Remark
This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin
Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb'
Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Igri x Franka
Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Igri x Franka
Locus in 'Barley, Consensus 2007, SSR' was a BIN marker in 'Barley, Consensus 2006, Marcel'
Possible Orthologs
Xmwg847-3



Probe
MWG847
Locus
Xmwg847-3
MWG847
Type
Genomic
STS
STS primers
5' GTCTTGGCCAGCTACTCCCG
5' CGCACCTGCACCAGAGGTCC
STS size
345
Amplification Conditions
STS annealing temperature 65-67 oC
Sequence
AJ234586
MWG847-5
Insert Enzyme
PstI
Source Species
Hordeum vulgare
Clone Vector
Bluescript
Excision Enzyme
PstI
Clone Location
Graner, Andreas
Clone Authority
Graner, Andreas
Data Source
Graner, Andreas94.03.08
Kuenzel, Gottfried00.03



Locus for Probe
Xmwg847-3
Type
RFLP
Map
Triticeae-Sorrells-3-update72.4
[ Show Nearby Loci ]
Map Data
Triticeae consensus
Probe
MWG847
Possible Orthologs
MWG847