Query (optional)   in Class  

GrainGenes Marker Report: MWG858

[Submit comment/correction]

Locus
MWG858
Type
RFLP
Synonym
SynonymPpd-H1 (Hordeum)
Chromosome
2H
Chromosome Arm
2HS
Map
Barley-Consensus-2H-29.2
[ Show all 18 ]
[ Show Nearby Loci ]
Map Data
Barley consensus
[ Show all 18 ]
Probe
MWG858
Associated Gene
Ppd-H1 (Hordeum)
Gene Class
Response to photoperiod
Reference
ReferenceWenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206.
[ Show all 6 ]
Data Source
Blake, Tom05.04.19
Remark
Number of populations contributing to the placement of MWG858 in the Barley, Consensus 2006 DArT maps = 1
The MWG858 RFLP/STS is a gene marker for the Ppd-H1 (Hordeum) gene
Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb'
Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex,Igri x Franka
Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex; Igri x Franka
Possible Orthologs
MWG858-2H
[ Show all 7 ]



Gene Associated with Locus
Ppd-H1 (Hordeum)
Gene Class
Response to photoperiod
Allele
Ppd-H1 Igri type (Hordeum)
Ppd-H1 Triumph type (Hordeum)
Locus
MWG858
Ppd-H1
Reference
ReferenceLaurie DA et al. (1994) Genetic analysis of a photoperiod response gene on the short arm of chromosome 2(2H) of Hordeum vulgare (barley). Heredity 72:619-627.
QTL
Ppd-H1 autumn
Ppd-H1 spring
Chromosome
2H
Chromosome Arm
2HS
Comment
A photoperiod response gene that affects flowering time under long days (13h or 16h light) but has little effect under short days (10h). In the field it is the major determinant of flowering time variation in the doubled haploid population. Its map location suggests it may be equivalent to the Ppd series of photoperiod response genes in wheat.



Probe
MWG858
Locus
Xmwg858-2
[ Show all 11 ]
Synonym
SynonymHAR35_21728
HAR35_3289
Reference
ReferenceGraner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256.
Type
Genomic
STS
STS primers
5' CGCCTCGTCTGTCATACTCA
5' AAAGAGGATGGCAGCCG
STS size
271
Amplification Conditions
STS annealing temperature 60-62 oC
Sequence
AJ234596
AJ234595
MWG858
MWG858-5
MWG858-3
Linkage Group
2H
2
Insert Enzyme
PstI
Source Species
Hordeum vulgare
Insert Size
1
1.4
Clone Vector
Bluescript
pBluescr.
pBS
Excision Enzyme
PstI
Clone Location
Graner, Andreas
Clone Authority
Graner, Andreas
Data Source
Graner, Andreas94.03.08
ATMI92.09
Kleinhofs, Andris96.05.08
Kuenzel, Gottfried00.03



Locus for Probe
D1.1_ctg1788
Type
BAC_contig
Map
Ta-Gale-2D-40.6
[ Show Nearby Loci ]
Probe
MWG858



Locus for Probe
HD016J2
Probe
MWG858



Locus for Probe
HI013P21
Probe
MWG858



Locus for Probe
MWG858-2H
Type
RFLP
Map
Hv-IxF-Stein-2H43.88
Hv-SxM-Stein-2H35.28
[ Show Nearby Loci ]
Map Data
Barley, IxF, Stein2006
Barley, SxM, Stein2006
Probe
MWG858
Possible Orthologs
MWG858
[ Show all 7 ]



Locus for Probe
Xmwg858
Type
RFLP
Chromosome
2R
Chromosome Arm
2HS
2RS
Map
Hbulbosum-PB1xPB11-256
[ Show all 8 ]
[ Show Nearby Loci ]
In QTL
Ppd-H1 autumn
Ppd-H1 spring
Map Data
Barley, CxHs
[ Show all 8 ]
Probe
MWG858
Possible Orthologs
MWG858
[ Show all 7 ]



Locus for Probe
Xmwg858-2
Type
RFLP
Chromosome Arm
2S
Map
Triticeae-Sorrells-265.6
[ Show Nearby Loci ]
Map Data
Triticeae consensus
Probe
MWG858
Possible Orthologs
MWG858
[ Show all 7 ]



Locus for Probe
Xmwg858-2A
Type
RFLP
Chromosome
2A
Chromosome Arm
2AS
Map
Ta-Gale-2A-40.6
[ Show Nearby Loci ]
Map Data
Wheat, Gale
Probe
MWG858
Possible Orthologs
MWG858
[ Show all 7 ]



Locus for Probe
Xmwg858-2B
Type
RFLP
Chromosome
2B
Chromosome Arm
2BS
Map
Ta-Gale-2B-40.6
[ Show Nearby Loci ]
Map Data
Wheat, Gale
Probe
MWG858
Possible Orthologs
MWG858
[ Show all 7 ]



Locus for Probe
Xmwg858-2D
Type
RFLP
Chromosome
2D
Chromosome Arm
2DS
Map
Ta-Gale-2D-40.6
[ Show Nearby Loci ]
Map Data
Wheat, Gale
Probe
MWG858
Possible Orthologs
MWG858
[ Show all 7 ]



Locus for Probe
Xmwg858-2R
Type
RFLP
Chromosome
2R
Map
Secale-PxP-2004-2R22.6
[ Show Nearby Loci ]
Map Data
Rye, P87 x P105, 2004
Species
Secale cereale
Probe
MWG858
Reference
ReferenceKhlestkina EK et al. (2004) Mapping of 99 new microsatellite-derived loci in rye (Secale cereale L.) including 39 expressed sequence tags Theoretical and Applied Genetics 109:725-732.
Possible Orthologs
MWG858
[ Show all 7 ]

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.