Query (optional)   in Class  

GrainGenes Marker Report: PSP3000

[Submit comment/correction]

Probe
PSP3000
Locus
Xpsp3000-1B
Xpsp3000-1B (Gli B1)
Yr10
Xpsp3000
Reference
ReferenceStephenson P et al. (1998) Fifty new microsatellite loci for the wheat genetic map. Theoretical and Applied Genetics 97:946-949.
ReferenceBryan GJ et al. (1997) Isolation and characterisation of microsatellites from hexaploid bread wheat Theoretical and Applied Genetics 94:557-563.
Type
PCR
SSR
PCR primers
Forward GCAGACCTGTGTCATTGGTC
Reverse GATATAGTGGCAGCAGGATACG
SSR size
286, 1B locus
Amplification Conditions
55C anneal
Source Species
Triticum aestivum
Data Source
Stephenson, Pauline2006.04



Locus for Probe
Xpsp3000
Type
Microsatellite
Chromosome
1B
1D
Map
Wheat, Avalon x Cadenza 1B13.2
Wheat-Composite2004-1B1
Wheat-Composite2004-1D26
[ Show Nearby Loci ]
Map Data
Wheat, Avalon x Cadenza
Wheat, Composite, 2004
Probe
PSP3000



Locus for Probe
Xpsp3000-1B
Chromosome
1B
Map
Ta-Courtot/CS-GPW-1B1
[ Show Nearby Loci ]
Map Data
Wheat, Courtot x Chinese Spring, GPW
Probe
PSP3000



Locus for Probe
Xpsp3000-1B (Gli B1)
Map
Ta-Synthetic/Opata-GPW-1B2.4
[ Show Nearby Loci ]
Map Data
Wheat, Synthetic x Opata, GPW
Probe
PSP3000



Locus for Probe
Yr10
Type
Trait
Synonym
Correct nameXrgaYr10-1D
Chromosome
1B
Chromosome Arm
1BS
Map
Wheat, Yr genes and QTL 1B0
Wheat-Composite2004-1B0
[ Show Nearby Loci ]
Map Data
Wheat, Yr genes and QTL
2 Point Data
Rg1/Yr10#1
Yr10/Gli-B1#1
Yr10/Glu-B1#1
Species
Triticum aestivum
Probe
PSP3000
Associated Gene
Yr10 (Triticum)
Gene Class
Reaction to Puccinia striiformis Westend.
Reference
ReferenceYuan C et al. (2018) Remapping of the stripe rust resistance gene Yr10 in common wheat Theoretical and Applied Genetics 131:1253-1262.
ReferenceLiu W et al. (2014) The Stripe Rust Resistance Gene Yr10 Encodes an Evolutionary-Conserved and Unique CC–NBS–LRR Sequence in Wheat 7:1740-1755.
Remark
Trait marker Xpsp3000-1B
Nearby marker on Composite map: Xpsp3000
Position on Composite map estimated by GrainGenes.
(Curator Note, VCB 03.2021) XrgaYr10-1D is curated in GrainGenes from Aegilops but is on 1BS on the consensus maps. We hope to clarify this soon.
(Curator Note, VCB 03.2021) XrgaYr10-1Dis curated in GrainGenes from Aegilops but is on 1BS on the consensus maps. We hope to clarify this soon.

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.