Query (optional)   in Class  

GrainGenes Marker Report: Ris44

[ Printable Version ]  [ Submit comment/correction ]

Locus
Ris44
Type
RFLP
Synonym
Other nameRisP103
Synonym103 ag hi
RisoP103
Chromosome
7H
Map
Hordeum-Consensus2005-SNP-7H117.817
[ Show all 13 ]
[ Show Nearby Loci ]
Map Data
Barley, Abiotic QTL Consensus
[ Show all 13 ]
Species
Hordeum vulgare
Probe
103 ag hi
RisoP103
Reference
ReferenceSzucs P et al. (2009) An Integrated Resource for Barley Linkage Map and Malting Quality QTL Alignment The Plant Genome 2:134-140.
ReferenceWenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206.
ReferenceRostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Data Source
Graner, Andreas96.11.14
Remark
Number of populations contributing to the placement of Ris44 in the Barley, Consensus 2006 DArT maps = 1
Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb'
Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Oregon Wolfe Barleys,Igri x Franka
Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Oregon Wolfe Dom x Rec; Igri x Franka



Probe for Locus
RisoP103
Locus
Ris44
Type
Genomic
Source Species
Hordeum vulgare
Clone Vector
pUC
Excision Enzyme
PstI



Probe for Locus
103 ag hi
Locus
Xris44
Ris44
Synonym
Other nameP103
RisP103
Type
Genomic
Insert Enzyme
PstI
Source Species
Hordeum vulgare
Source Germplasm
Pallas (barley)
Source Tissue
Leaf
Insert Size
1
Clone Vector
pUC119
Vector Enzyme
PstI
Excision Enzyme
PstI
Vector PCR primers
Universal/reverse
Clone Location
Giese, Henriette
Clone Authority
Giese, Henriette
Data Source
Heiberg, Ann-Charlotte95.10.17



Probe
Ris44
Locus
Ris44-7H
STS primers
5' GCACAAATCCGATCTTTGG
5' ATCCACTTGCTTCTCCTTCC
STS size
344
Amplification Conditions
STS annealing temperature 55-58 oC
Sequence
BH854345
BH854346
RIS44-5
RIS44-3
Data Source
Kuenzel, Gottfried00.03



Locus for Probe
Ris44-7H
Map
Hv-DxR-Stein-7H111.97
Hv-IxF-Stein-7H128.19
[ Show Nearby Loci ]
Map Data
Barley, IxF, Stein2006
Barley, OWB, Stein2006
Probe
Ris44