Query (optional)   in Class  

GrainGenes Marker Report: SCM102

[ Printable Version ]  [ Submit comment/correction ]

Probe
SCM102
Locus
XScm102
Reference
ReferenceSaal B and Wricke G (1999) Development of simple sequence repeat markers in rye (Secale cereale L.) Genome 42:964-972.
Remarks
Contains repeat (AG)27
Primer pairs for microsatellite markers are available for academic use. Requests should be addressed to http://www.bafz.de/primer/start/php15
Type
PCR
SSR
PCR primers
5' AACAAGTGCAGAACTCGCGT
3' CAGAAAGTCTTGGGGCCAG
SSR size
208
Amplification Conditions
Annealing temperature = 60 degrees C
Source Species
Secale cereale



Locus for Probe
XScm102
Type
Microsatellite
Chromosome
7R
Chromosome Arm
7RL
Map
Rye-2009-Consensus-7R15.7
Secale-PxP-update-7R78.3
[ Show Nearby Loci ]
Map Data
Rye, P87 x P105, update
Rye_2009_consensus
Probe
SCM102
Scm102