Query (optional)   in Class  

GrainGenes Marker Report: SCM138

[ Printable Version ]  [ Submit comment/correction ]

Probe
SCM138
Locus
Xscm138a
XScm138b
Reference
ReferenceSaal B and Wricke G (1999) Development of simple sequence repeat markers in rye (Secale cereale L.) Genome 42:964-972.
Remarks
Contains repeat (AC)23
Primer pairs for microsatellite markers are available for academic use. Requests should be addressed to http://www.bafz.de/primer/start/php20
Type
PCR
SSR
PCR primers
5' ATAGCCGCAGATGGTTGAGGAC
3' GAGAAGTCTACAAATCAAGGGGGC
SSR size
188
Amplification Conditions
Annealing temperature = 60 degrees C
Source Species
Secale cereale



Locus for Probe
Xscm138a
Type
Microsatellite
Chromosome
5R
Chromosome Arm
5RS
Map
Secale-PxP-update-5R52.6
[ Show Nearby Loci ]
Map Data
Rye, P87 x P105, update
Probe
SCM138



Locus for Probe
XScm138b
Type
Microsatellite
Chromosome
7R
Chromosome Arm
7RS
Map
Rye-2009-Consensus-7R45.7
Secale-PxP-update-7R63.3
[ Show Nearby Loci ]
Map Data
Rye, P87 x P105, update
Rye_2009_consensus
Probe
SCM138
Scm138b