Query (optional)   in Class  

GrainGenes Marker Report: SCM43

[ Printable Version ]  [ Submit comment/correction ]

Probe
SCM43
Locus
XScm43
Reference
ReferenceSaal B and Wricke G (1999) Development of simple sequence repeat markers in rye (Secale cereale L.) Genome 42:964-972.
Remarks
Contains repeat (GT)11
Primer pairs for microsatellite markers are available for academic use. Requests should be addressed to http://www.bafz.de/primer/start/php9
Type
PCR
SSR
PCR primers
5' CTAGGGGATTACAGGGAGGGCA
3' GTTCCCTTGTCCTACTCGTTACCG
SSR size
100
Amplification Conditions
Annealing temperature = 60 degrees C
Source Species
Secale cereale



Locus for Probe
XScm43
Type
Microsatellite
Chromosome
2R
Chromosome Arm
2RS
Map
Rye-2009-Consensus-2R50.1
Secale-PxP-update-2R46.3
[ Show Nearby Loci ]
Map Data
Rye, P87 x P105, update
Rye_2009_consensus
Probe
SCM43
Scm43