Query (optional)   in Class  

GrainGenes Marker Report: Sr2

[ Printable Version ]  [ Submit comment/correction ]

Locus
Sr2
Type
Gene
Trait
Chromosome
3B
Chromosome Arm
3BS
Map
Triticum-Genes-3B-40.3
Wheat-2014-Consensus-Ug99-Update_3B7.68
Wheat-Composite2004-3B12
Wheat_Consensus_2014_Ug99_Rust_3B7.68
[ Show Nearby Loci ]
Map Data
Wheat genes
Wheat-2014-Consensus-Ug99-Update
Wheat_Consensus_2014_Ug99_Rust
Species
Triticum aestivum
Probe
csSr2
WMS533
Associated Gene
Sr2 (Triticum)
Gene Class
Reaction to Puccinia graminis Pers.
Reference
ReferenceYu L et al. (2014) A consensus map for Ug99 stem rust resistance loci in wheat. Theoretical and Applied Genetics 127:1561-1581.
ReferenceMago R et al. (2010) An accurate DNA marker assay for stem rust resistance gene Sr2 in wheat Theoretical and Applied Genetics 122:735-744.
ReferenceSpielmeyer W et al. (2003) Identification and validation of markers linked to broad-spectrum stem rust resistance gene Sr2 in wheat (Triticum aestivum L.) Crop Science 43:333-336.
ReferenceSingh RP and McIntosh RA (1984) Complementary genes for resistance to Puccinia recondita tritici in Triticum aestivum II. Cytogenetic studies. Canadian Journal of Genetics and Cytology 26:736-742.
ReferenceSpielmeyer W et al. MAS Wheat. Bringing Genomics to the Wheat Fields. Disease resistance. Stem Rust Resistance. Sr2 MAS Wheat. Marker Assisted Selection in Wheat.
Data Source
Matthews, David E.
Remark
Trait marker Xgwm533-3B.1
Nearby marker on Composite map: Xgwm533a
Position on Composite map estimated by GrainGenes.



Probe for Locus
WMS533
Locus
Xgwm533-3B
[ Show all 14 ]
Reference
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
General Remarks
Insert contains repeat (CT)18(CA)20
PRIMER SEQUENCE IS AVAILABLE FOR PUBLIC RESEARCH ONLY. REQUESTS FOR COMMERCIAL USE SHOULD BE DIRECTED TO M. ROEDER.
Type
PCR
SSR
PCR primers
5' AAGGCGAATCAAACGGAATA 3'
5' GTTGCTTTAGGGGAAAAGCC 3'
Amplification Conditions
3 min at 94 deg C; 45 cycles with 1 min at 94 deg C, 1 min at 60 deg C, and 2 min at 72 deg C; and a final extension step of 10 min at 72 deg C
Polymorphism
WMS533
Source Species
Triticum aestivum
Source Germplasm
Chinese Spring
Data Source
Roeder, Marion S.98.09.15



Probe for Locus
csSr2
Locus
Sr2
Reference
ReferenceMago R et al. (2010) An accurate DNA marker assay for stem rust resistance gene Sr2 in wheat Theoretical and Applied Genetics 122:735-744.
ReferenceSpielmeyer W et al. MAS Wheat. Bringing Genomics to the Wheat Fields. Disease resistance. Stem Rust Resistance. Sr2 MAS Wheat. Marker Assisted Selection in Wheat.
Type
CAPS
PCR primers
csSr2-F 5'- CAA GGG TTG CTA GGA TTG GAA AAC -3A'
csSr2-R 5'- AGA TAA CTC TTA TGA TCT TAC ATT TTT CTG -3A
Amplification Conditions
Denaturing step: 95C, 2 min. Amplification step (30 cycles): 95C, 30 sec; 60C, 40 sec; 72C, 50 sec. Extension step: 72C, 5 min. 15C, 1 min
Specificity
Detects three different alleles of Sr2: 'null', Marquis, and Hope. See MAS wheat page for more details



Gene Associated with Locus
Sr2 (Triticum)
Gene Class
Reaction to Puccinia graminis Pers.
Locus
Sr2
Reference
ReferenceYu L et al. (2014) A consensus map for Ug99 stem rust resistance loci in wheat. Theoretical and Applied Genetics 127:1561-1581.
[ Show all 15 ]
URL
Protocol for Sr2 at MASwheat
QTL
QTL1428_3B-Haile_et_al._2012a
Chromosome
3B
ReferenceHare RA and McIntosh RA (1979) Genetic and cytogenetic studies of durable adult-plant resistances in 'Hope' and related cultivars to wheat rusts. Zeitschrift fur Pflanzenzuchtung 83:350-367.
Chromosome Arm
3BS
ReferenceHare RA and McIntosh RA (1979) Genetic and cytogenetic studies of durable adult-plant resistances in 'Hope' and related cultivars to wheat rusts. Zeitschrift fur Pflanzenzuchtung 83:350-367.
Germplasm
Hexaploid stockHOPPS
ReferenceHare RA and McIntosh RA (1979) Genetic and cytogenetic studies of durable adult-plant resistances in 'Hope' and related cultivars to wheat rusts. Zeitschrift fur Pflanzenzuchtung 83:350-367.
[ Show all 6 ]
Comment
Adult plant response. Recessive allele. This gene is associated with pseudo-black chaff and occurs very frequently in commercial wheats.
Hexaploid stocks: see also 346 and 1040.
Wheat Gene Catalog Reference
1040
ReferenceSunderwirth SD and Roelfs AP (1980) Greenhouse evaluation of the adult plant resistance of Sr2 to wheat stem rust. Phytopathology 70:634-637.
346
ReferenceHare RA and McIntosh RA (1979) Genetic and cytogenetic studies of durable adult-plant resistances in 'Hope' and related cultivars to wheat rusts. Zeitschrift fur Pflanzenzuchtung 83:350-367.
Info Source
ReferenceMcIntosh RA et al. (1995) Catalogue of gene symbols for wheat. Proceedings of the 8th International Wheat Genetics Symposium 1333-1500.
Data Curator
Hart, Gary E.95.08.24