Query (optional)   in Class  

GrainGenes Marker Report: Sr22

[ Printable Version ]  [ Submit comment/correction ]

Locus
Sr22
Type
Gene
Trait
Chromosome
7A
Chromosome Arm
7AL
Map
Triticum-Genes-7A29.4
Wheat-2014-Consensus-Ug99-Update_7A112
Wheat-Composite2004-7A171
[ Show Nearby Loci ]
Map Data
Wheat genes
Wheat-2014-Consensus-Ug99-Update
2 Point Data
Centromere/Sr22#1Distance: 27 cM
[ Show all 7 ]
Species
Triticum aestivum
Probe
BARC121
CFA2019
CFA2123
WMC633
Associated Gene
Sr22 (Triticum)
Gene Class
Reaction to Puccinia graminis Pers.
Reference
ReferenceYu L et al. (2014) A consensus map for Ug99 stem rust resistance loci in wheat. Theoretical and Applied Genetics 127:1561-1581.
ReferenceKhan RR et al. (2005) Molecular mapping of stem and leaf rust resistance in wheat Theoretical and Applied Genetics 111:846-850.
ReferenceThe TT (1973) Chromosome location of genes conditioning stem rust resistance transferred from diploid to hexaploid wheat. Nature New Biology 241:256.
ReferenceBrown-Guedira G et al. MAS Wheat. Bringing Genomics to the Wheat Fields. Disease resistance. Stem Rust Resistance. Sr22 MAS Wheat. Marker Assisted Selection in Wheat.
Data Source
Matthews, David E.
Remark
Trait marker Xcfa2019-7A
Nearby marker on Composite map: Xgwm282
Position on Composite map estimated by GrainGenes.
The location on the 2014 Ug99 Consensus Map is approximate.



Probe for Locus
CFA2019
Locus
Xcfa2019-7A
Sr22
cfa2019
Xcfa2019
Reference
ReferenceSourdille P et al. (2001) Improvement of the genetic maps of wheat using new microsatellite markers Plant & Animal Genome IX Abstracts 167.
General Remarks
Quality Score = B
Quality scores reflect the quality of amplification (from A very good quality to D multiple banding pattern : A and B can be used on capillary systems)
Amplifies motif: (CA)14
Regularity of motif is perfect
Type
PCR
SSR
PCR primers
Forward 5' GACGAGCTAACTGCAGACCC 3'
Reverse 5' CTCAATCCTGATGCGGAGAT 3'
SSR size
217
Amplification Conditions
5 minutes at 94 degrees; 30 cycles (94 degrees for 30 seconds; 60 degrees for 30 seconds; 72 degrees for 30 seconds); 10 minutes at 72 degrees
Linkage Group
7A
Source Species
Triticum urartu
Data Source
Sourdille, Pierre



Probe for Locus
CFA2123
Locus
Xcfa2123-7A
[ Show all 9 ]
Reference
ReferenceSourdille P et al. (2001) Improvement of the genetic maps of wheat using new microsatellite markers Plant & Animal Genome IX Abstracts 167.
General Remarks
Quality Score = A
Quality scores reflect the quality of amplification (from A very good quality to D multiple banding pattern : A and B can be used on capillary systems)
Amplifies motif: (GA)30
Regularity of motif is perfect
Type
PCR
SSR
PCR primers
Forward 5' CGGTCTTTGTTTGCTCTAAACC 3'
Reverse 5' ACCGGCCATCTATGATGAAG 3'
SSR size
259
Amplification Conditions
5 minutes at 94 degrees; 30 cycles (94 degrees for 30 seconds; 60 degrees for 30 seconds; 72 degrees for 30 seconds); 10 minutes at 72 degrees
Linkage Group
7A
Source Species
Triticum urartu
Data Source
Sourdille, Pierre



Probe for Locus
WMC633
Locus
Xwmc633-7A
Sr22
wmc633
Reference
ReferenceSomers DJ and Isaac P (2004) SSRs from the Wheat Microsatellite Consortium.
General Remarks
Wheat Microsatellite Consortium Project 2
Donor: Somers, Agriculture Canada
Type
PCR
SSR
PCR primers
Forward ACACCAGCGGGGATATTTGTTAC
Reverse GTGCACAAGACATGAGGTGGATT
SSR size
143 bases expected, Chinese Spring
Amplification Conditions
61C anneal.
Source Species
Triticum aestivum
Data Source
Somers, Daryl J.2004.10
Somers, Daryl J.2006.07



Probe for Locus
BARC121
Locus
Xbarc121-7A
[ Show all 14 ]
General Remarks
Contains motif : (CT)17
BARC primer pairs are developed by P. Cregan, Q. Song and associates at the USDA-ARS Beltsville Agriculture Research Station. Meiotic map information was developed by J.R. Shi, R. Ward and associates at Michigan State University. Deletion map information was developed by B.Gill, S. Singh and associates at Kansas State University. Funding for this research is provided by USDA-ARS in conjunction with the U.S. Wheat and Barley Scab Initiative.
Type
PCR
SSR
PCR primers
5' ACTGATCAGCAATGTCAACTGAA 3'
5' CCGGTGTCTTTCCTAACGCTATG 3'
Amplification Conditions
Annealing temperature = 50
Sequence
BV211413
Source Species
Triticum aestivum
Data Source
Ward, Rick



Gene Associated with Locus
Sr22 (Triticum)
Gene Class
Reaction to Puccinia graminis Pers.
Locus
Sr22
Reference
ReferenceBabiker EM et al. (2015) Mapping resistance to the Ug99 race group of the stem rust pathogen in a spring wheat landrace Theoretical and Applied Genetics 128:605-612.
[ Show all 7 ]
URL
Protocol for Sr22 at MASwheat
QTL
QTL1429_7A-Haile_et_al._2012a
Chromosome
7A
ReferenceKerber ER and Dyck PL (1973) Inheritance of stem rust resistance transferred from diploid wheat (Triticum monococcum) to tetraploid and hexaploid wheat and chromosome location of the gene involved. Canadian Journal of Genetics and Cytology 15:397-409.
Chromosome Arm
7AL
ReferenceThe TT (1973) Chromosome location of genes conditioning stem rust resistance transferred from diploid to hexaploid wheat. Nature New Biology 241:256.
Germplasm
Hexaploid stockChinese Spring/3/Steinwedel*2/2/Spelmar/Triticum boeoticum
ReferenceThe TT (1973) Chromosome location of genes conditioning stem rust resistance transferred from diploid to hexaploid wheat. Nature New Biology 241:256.
[ Show all 8 ]
Comment
Diploid stocks: various T. monococcum accessions (467, 1059)
Wheat Gene Catalog Reference
467
ReferenceKerber ER and Dyck PL (1973) Inheritance of stem rust resistance transferred from diploid wheat (Triticum monococcum) to tetraploid and hexaploid wheat and chromosome location of the gene involved. Canadian Journal of Genetics and Cytology 15:397-409.
1059
ReferenceThe TT (1973) Chromosome location of genes conditioning stem rust resistance transferred from diploid to hexaploid wheat. Nature New Biology 241:256.
Info Source
ReferenceMcIntosh RA et al. (1995) Catalogue of gene symbols for wheat. Proceedings of the 8th International Wheat Genetics Symposium 1333-1500.
Data Curator
Hart, Gary E.95.08.24