Query (optional)   in Class  

GrainGenes Marker Report: WBE105

[ Printable Version ]  [ Submit comment/correction ]

Locus
WBE105
Type
CAPS
Chromosome
2H
Map
Hv-Consensus2006-Marcel-2H41.29
Hv-Integrated2009-2H40.4
Hv-L94/Vada-2006-2H51.24
[ Show Nearby Loci ]
Map Data
Barley, Consensus 2006, Marcel
Barley, Integrated, Marcel 2009
Barley, L94 x Vada, 2006
Species
Hordeum vulgare
Probe
WBE105
Remark
Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb'
Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = L94 x Vada
Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : L94 x Vada; Oregon Wolfe Dom x Rec



Probe
WBE105
Locus
WBE105
Reference
ReferenceMarcel TC et al. (2007) A high-density consensus map of barley to compare the distribution of QTLs for partial resistance to Puccinia hordei and of defence gene homologues. Theoretical and Applied Genetics 114:487-500.
Remarks
Restriction Enzyme for CAPS marker is BccI
PCR primers
5' catggccgccgtgagcagtgac 3'
5' gcagttggcccggagagttgtgg 3'
Amplification Conditions
5 min at 94 deg C; 35 cycles with 30 sec at 94 deg C, 30 sec at 62 deg C, and 1 min at 72 deg C; and a final extension step of 7 min at 72 deg C
Source Species
Hordeum vulgare
Data Source
Niks, Rients E.2006.08
Marcel, Thierry C.2006.08