Query (optional)   in Class  

GrainGenes Marker Report: WMC633

[Submit comment/correction]

Probe
WMC633
Locus
Xwmc633-7A
Sr22
wmc633
Reference
ReferenceSomers DJ and Isaac P (2004) SSRs from the Wheat Microsatellite Consortium.
Remarks
Wheat Microsatellite Consortium Project 2
Donor: Somers, Agriculture Canada
Type
PCR
SSR
PCR primers
Forward ACACCAGCGGGGATATTTGTTAC
Reverse GTGCACAAGACATGAGGTGGATT
SSR size
143 bases expected, Chinese Spring
Amplification Conditions
61C anneal.
Source Species
Triticum aestivum
Data Source
Somers, Daryl J.2004.10
Somers, Daryl J.2006.07



Locus for Probe
wmc633
Type
Microsatellite
Map
Wheat, Yr genes and QTL 7A93.5
Wheat-2014-Consensus-Ug99-Update_7A112.37
Wheat_Consensus_2014_Ug99_Rust_7A112.37
Wheat_Yr_2021-7A232.4
[ Show Nearby Loci ]
Map Data
Wheat, Yr genes and QTL
Wheat, Yr Update, 2021
Wheat-2014-Consensus-Ug99-Update
Wheat_Consensus_2014_Ug99_Rust
Probe
WMC633
Possible Orthologs
Xwmc633-7A



Locus for Probe
Sr22
Type
Gene
Trait
Chromosome
7A
Chromosome Arm
7AL
Map
Triticum-Genes-7A29.4
Wheat-2014-Consensus-Ug99-Update_7A112
Wheat-Composite2004-7A171
[ Show Nearby Loci ]
Map Data
Wheat genes
Wheat-2014-Consensus-Ug99-Update
2 Point Data
Centromere/Sr22#1
[ Show all 7 ]
Species
Triticum aestivum
Probe
BARC121
CFA2019
CFA2123
WMC633
Associated Gene
Sr22 (Triticum)
Gene Class
Reaction to Puccinia graminis Pers.
Reference
ReferenceYu L et al. (2014) A consensus map for Ug99 stem rust resistance loci in wheat. Theoretical and Applied Genetics 127:1561-1581.
ReferenceKhan RR et al. (2005) Molecular mapping of stem and leaf rust resistance in wheat Theoretical and Applied Genetics 111:846-850.
ReferenceThe TT (1973) Chromosome location of genes conditioning stem rust resistance transferred from diploid to hexaploid wheat. Nature New Biology 241:256.
ReferenceBrown-Guedira G et al. MAS Wheat. Bringing Genomics to the Wheat Fields. Disease resistance. Stem Rust Resistance. Sr22 MAS Wheat. Marker Assisted Selection in Wheat.
Data Source
Matthews, David E.
Remark
Trait marker Xcfa2019-7A
Nearby marker on Composite map: Xgwm282
Position on Composite map estimated by GrainGenes.
The location on the 2014 Ug99 Consensus Map is approximate.



Locus for Probe
Xwmc633-7A
Type
Microsatellite
Chromosome
7A
Map
Ta-SSR-2004-7A106.5
[ Show Nearby Loci ]
Map Data
Wheat, Consensus SSR, 2004
Probe
WMC633
Reference
ReferenceSomers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114.
Possible Orthologs
wmc633

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.