Query (optional)   in Class  

GrainGenes Marker Report: WMS18

[ Submit comment/correction ]

Probe
WMS18
Locus
Xgwm18
[ Show all 7 ]
Reference
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
ReferenceRoeder MS et al. (1995) Abundance, variability and chromosomal location of microsatellites in wheat. Molecular and General Genetics 246:327-333.
Remarks
Insert contains repeat (CA)17GA(TA)4
PRIMER SEQUENCE IS AVAILABLE FOR PUBLIC RESEARCH ONLY. REQUESTS FOR COMMERCIAL USE SHOULD BE DIRECTED TO M. ROEDER.
Repeat type (CA)x17GA(TA)x4.
Product size 186 bp in Chinese Spring.
Type
PCR
SSR
PCR primers
5' TGGCGCCATGATTGCATTATCTTC 3'
5' GGTTGCTGAAGAACCTTATTTAGG 3'
Amplification Conditions
3 min at 94 deg C; 45 cycles with 1 min at 94 deg C, 1 min at 50 deg C, and 2 min at 72 deg C; and a final extension step of 10 min at 72 deg C
Polymorphism
WMS18
Source Species
Triticum aestivum
Source Germplasm
Chinese Spring
Data Source
Roeder, Marion S.98.09.15
Roeder, Marion S.94.10.17



Locus for Probe
gwm18-6D
Type
Microsatellite
Map
KPxKC-6D69.4
[ Show Nearby Loci ]
Map Data
Wheat, Klein Proteo x Klein Chaja
Probe
WMS18
Possible Orthologs
Xgwm18
[ Show all 6 ]



Locus for Probe
gwm18
Type
Microsatellite
Map
Wheat, Yr genes and QTL 1B34.6
[ Show Nearby Loci ]
In QTL
QYrs.Z86-1B
Map Data
Wheat, Yr genes and QTL
Probe
WMS18
Possible Orthologs
Xgwm18
[ Show all 6 ]



Locus for Probe
gwm18-1B
Type
Microsatellite
Map
Wheat_AB, Langdon x G18-16 1B49.7
Wheat_AB, Latino x MG5323 1B24.7
Wheat_AB, Simeto x Molise Colli 1B34.5
Wheat_AB_2015_Consensus-1B35.6
[ Show Nearby Loci ]
Map Data
Wheat_AB, Langdon x G18-16
Wheat_AB, Latino x MG5323
Wheat_AB, Simeto x Molise Colli
Wheat_AB_2015_Consensus
Probe
WMS18
Possible Orthologs
Xgwm18
[ Show all 6 ]



Locus for Probe
Xgwm18
Type
Microsatellite
Chromosome
1B
Chromosome Arm
1BL
Map
Ta-NxW-1B66.8
Tt-LxG-1B74
Wheat, Avalon x Cadenza 1B53.6
Wheat-Composite2004-1B49
[ Show Nearby Loci ]
Map Data
T. turgidum, Langdon x G18-16
Wheat, Avalon x Cadenza
Wheat, Composite, 2004
Wheat, Nanda2419 x Wangshuibai
Probe
WMS18
Possible Orthologs
Xgwm0018-1B
[ Show all 6 ]



Locus for Probe
Xgwm0018-1B
Type
Microsatellite
Map
P91193D1/P92201D5-1B152.2
[ Show Nearby Loci ]
Map Data
Wheat, P91193D1 x P92201D5
Probe
WMS18
Possible Orthologs
Xgwm18
[ Show all 6 ]



Locus for Probe
Xgwm18-1B
Type
Microsatellite
Chromosome
1B
Chromosome Arm
1BS
Map
Chinese_Spring_Deletion_SSR_1B-0.25
[ Show all 7 ]
[ Show Nearby Loci ]
In QTL
QLd.sfr-1B
QLr.sfr-1B
QLtn.sfr-1B
Breakpoint Interval
C-1BS10-0.50
Map Data
T. turgidum, Messapia x dicoccoides, SSR
[ Show all 7 ]
Probe
WMS18
Reference
ReferenceSomers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114.
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
Data Source
Roeder, Marion S.98.09.15
Remark
In Map Ta-Synthetic/Opata-SSR-1B, the interval most likely to contain locus is between Xbcd1124 and Xcdo1173
Possible Orthologs
Xgwm18
[ Show all 6 ]



Locus for Probe
Xgwm18-4B
Type
Microsatellite
Chromosome
4B
Chromosome Arm
4BS
Probe
WMS18
Reference
ReferenceRoeder MS et al. (1995) Abundance, variability and chromosomal location of microsatellites in wheat. Molecular and General Genetics 246:327-333.
Possible Orthologs
Xgwm18
[ Show all 6 ]

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.