Query (optional)   in Class  

GrainGenes Marker Report: WMS210

[ Submit comment/correction ]

Probe
WMS210
Locus
Xgwm210.2-2A
[ Show all 11 ]
Reference
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
Remarks
Insert contains repeat (GA)20
PRIMER SEQUENCE IS AVAILABLE FOR PUBLIC RESEARCH ONLY. REQUESTS FOR COMMERCIAL USE SHOULD BE DIRECTED TO M. ROEDER.
Type
PCR
SSR
PCR primers
5' TGCATCAAGAATAGTGTGGAAG 3'
5' TGAGAGGAAGGCTCACACCT 3'
Amplification Conditions
3 min at 94 deg C; 45 cycles with 1 min at 94 deg C, 1 min at 60 deg C, and 2 min at 72 deg C; and a final extension step of 10 min at 72 deg C
Polymorphism
WMS210
Source Species
Triticum aestivum
Source Germplasm
Chinese Spring
Data Source
Roeder, Marion S.98.09.15



Locus for Probe
gwm210
Type
Microsatellite
Map
Durum Wheat, NSGC Lr 2B5.9
Wheat, Yr genes and QTL 2B10.7
Wheat, Yr genes and QTL 2D5.2
[ Show Nearby Loci ]
Map Data
Durum Wheat, NSGC Lr
Wheat, Yr genes and QTL
Probe
WMS210
Possible Orthologs
Xgwm210
[ Show all 10 ]



Locus for Probe
gwm210-2B
Type
Microsatellite
Map
Wheat_AB, Ben x PI41025 2B9.1
Wheat_AB, Colosseo x Lloyd 2B16.4
Wheat_AB, Meridiano x Claudio 2B1.2
Wheat_AB, Simeto x Molise Colli 2B5.2
Wheat_AB_2015_Consensus-2B5.9
[ Show Nearby Loci ]
Map Data
Wheat_AB, Ben x PI41025
Wheat_AB, Colosseo x Lloyd
Wheat_AB, Meridiano x Claudio
Wheat_AB, Simeto x Molise Colli
Wheat_AB_2015_Consensus
Probe
WMS210
Possible Orthologs
Xgwm210
[ Show all 10 ]



Locus for Probe
Sm1
Type
Trait
Chromosome
2B
Chromosome Arm
2BS
Map
Wheat-Composite2004-2B5
[ Show Nearby Loci ]
Species
Triticum aestivum
Probe
WMS210
Associated Gene
Sm1 (Triticum)
Gene Class
Reaction to Sitodiplosis mosellana (Gehin)
Reference
ReferenceThomas J et al. (2005) Chromosome location and markers of Sm1: a gene of wheat that conditions antibiotic resistance to orange wheat blossom midge. Molecular Breeding 15:183-192.
Remark
Trait marker Xgwm210-2B
Nearby marker on Composite map: Xgwm210.1
Position on Composite map estimated by GrainGenes.



Locus for Probe
Xgwm210
Type
Microsatellite
Map
Svevo/Ciccio-2B0
Ta-NxW-2B6.4
Wheat, Avalon x Cadenza 2B11.2
[ Show Nearby Loci ]
Breakpoint Interval
2BS3-0.84-1.00
Map Data
Durum wheat, Svevo x Ciccio
Wheat, Avalon x Cadenza
Wheat, Nanda2419 x Wangshuibai
Probe
WMS210
Possible Orthologs
Xgwm210-2A
[ Show all 10 ]



Locus for Probe
Xgwm210-2A
Type
Microsatellite
Chromosome
2A
Chromosome Arm
2AS
Map
Ta-Synthetic/Opata-BARC-2A6.3
Ta-Synthetic/Opata-GPW-2A3
Triticum-AxF-2A0.7
[ Show Nearby Loci ]
Map Data
Wheat, Arina x Forno
Wheat, Synthetic x Opata, BARC
Wheat, Synthetic x Opata, GPW
Species
Triticum aestivum
Probe
WMS210
Reference
ReferencePaillard S et al. (2003) An integrative genetic linkage map of winter wheat (Triticum aestivum L.) Theoretical and Applied Genetics 107:1235-1242.
Possible Orthologs
Xgwm210
[ Show all 10 ]



Locus for Probe
Xgwm210-2B
Type
Microsatellite
Chromosome
2B
Chromosome Arm
2BS
Map
Chinese_Spring_Deletion_SSR_2B-0.92
Conan/Reeder-2B25.1982
Ta-SSR-2004-2B5.9
Ta-Synthetic/Opata-SSR-2B4.8
Tturgidum-SSR-2B-103
[ Show Nearby Loci ]
Breakpoint Interval
2BS4-0.84-1.00
Map Data
Durum wheat, Svevo x Ciccio
[ Show all 6 ]
Probe
WMS210
Reference
ReferenceSomers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114.
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
Data Source
Roeder, Marion S.98.09.15
Remark
In Map Ta-Synthetic/Opata-SSR-2B, the intervals most likely to contain locus are Xbcd348 - Xcdo456 or Xcdo456 - Xcdo447
Possible Orthologs
Xgwm210
[ Show all 10 ]



Locus for Probe
Xgwm210-2D
Type
Microsatellite
Chromosome
2D
Chromosome Arm
2DS
Map
Chinese_Spring_Deletion_SSR_2D-0.735
[ Show all 6 ]
[ Show Nearby Loci ]
Breakpoint Interval
2DS5-0.47-1.00
Map Data
Wheat, Consensus SSR, 2004
[ Show all 6 ]
Probe
WMS210
Reference
ReferenceSomers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114.
ReferenceSomers DJ et al. (2003) Molecular mapping of novel genes controlling Fusarium head blight resistance and deoxynivalenol accumulation in spring wheat Genome 46:555-564.
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
Data Source
Roeder, Marion S.98.09.15
Remark
In Map Ta-Synthetic/Opata-SSR-2D, the intervals most likely to contain locus are Xbcd102 - Xgwm296 or Xgwm296 - Xgwm261
Possible Orthologs
Xgwm210
[ Show all 10 ]



Locus for Probe
Xgwm210.1
Type
Microsatellite
Chromosome
2A
2B
Map
Wheat-Composite2004-2A4
Wheat-Composite2004-2B4
[ Show Nearby Loci ]
Map Data
Wheat, Composite, 2004
Probe
WMS210
Possible Orthologs
Xgwm210
[ Show all 10 ]



Locus for Probe
Xgwm210.1-2B
Type
Microsatellite
Map
CS/SQ1-2B0
[ Show Nearby Loci ]
Map Data
Wheat, Chinese Spring x SQ1
Probe
WMS210
Possible Orthologs
Xgwm210
[ Show all 10 ]



Locus for Probe
Xgwm210.2
Type
Microsatellite
Chromosome
2D
Map
Wheat-Composite2004-2D17
[ Show Nearby Loci ]
Map Data
Wheat, Composite, 2004
Probe
WMS210
Possible Orthologs
Xgwm210
[ Show all 10 ]



Locus for Probe
Xgwm210.2-2A
Type
Microsatellite
Map
CS/SQ1-2A1.2
[ Show Nearby Loci ]
Map Data
Wheat, Chinese Spring x SQ1
Probe
WMS210
Possible Orthologs
Xgwm210
[ Show all 10 ]

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.