Query (optional)   in Class  

GrainGenes Marker Report: WMS273

[ Submit comment/correction ]

Probe
WMS273
Locus
Xgwm273-1B
[ Show all 6 ]
Reference
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
Remarks
Insert contains repeat (GA)18
PRIMER SEQUENCE IS AVAILABLE FOR PUBLIC RESEARCH ONLY. REQUESTS FOR COMMERCIAL USE SHOULD BE DIRECTED TO M. ROEDER.
Type
PCR
SSR
PCR primers
5' ATTGGACGGACAGATGCTTT 3'
5' AGCAGTGAGGAAGGGGATC 3'
Amplification Conditions
3 min at 94 deg C; 45 cycles with 1 min at 94 deg C, 1 min at 55 deg C, and 2 min at 72 deg C; and a final extension step of 10 min at 72 deg C
Polymorphism
WMS273
Source Species
Triticum aestivum
Source Germplasm
Chinese Spring
Data Source
Roeder, Marion S.98.09.15



Locus for Probe
gwm273-6B
Type
Microsatellite
Chromosome
6B
Probe
WMS273
Possible Orthologs
Xgwm273
Xgwm273-1B
Xgwm273-6B
gwm273
gwm273-1B



Locus for Probe
gwm273
Type
Microsatellite
Map
Wheat, Yr genes and QTL 1B34.6
Wheat, Yr genes and QTL 6B42.9
[ Show Nearby Loci ]
Map Data
Wheat, Yr genes and QTL
Probe
WMS273
Possible Orthologs
Xgwm273
Xgwm273-1B
Xgwm273-6B
gwm273-1B
gwm273-6B



Locus for Probe
gwm273-1B
Type
Microsatellite
Map
Wheat_AB, Kofa x UC1113 1B15
Wheat_AB, Latino x MG5323 1B24.7
Wheat_AB_2015_Consensus-1B35.6
[ Show Nearby Loci ]
Map Data
Wheat_AB, Kofa x UC1113
Wheat_AB, Latino x MG5323
Wheat_AB_2015_Consensus
Probe
WMS273
Possible Orthologs
Xgwm273
Xgwm273-1B
Xgwm273-6B
gwm273
gwm273-6B



Locus for Probe
Xgwm273
Type
Microsatellite
Chromosome
1B
Map
Wheat-Composite2004-1B55
[ Show Nearby Loci ]
Map Data
Wheat, Composite, 2004
Probe
WMS273
Possible Orthologs
Xgwm273-1B
Xgwm273-6B
gwm273
gwm273-1B
gwm273-6B



Locus for Probe
Xgwm273-1B
Type
Microsatellite
Chromosome
1B
Chromosome Arm
1BS
Map
Chinese_Spring_Deletion_SSR_1B-0.25
[ Show all 8 ]
[ Show Nearby Loci ]
Breakpoint Interval
C-1BS10-0.50
Map Data
Durum wheat, Kofa x UC1113
[ Show all 8 ]
2 Point Data
Yr15/Xgwm273
Probe
WMS273
Reference
ReferenceSomers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114.
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
Data Source
Roeder, Marion S.98.09.15
Remark
In Map Ta-Synthetic/Opata-SSR-1B, the interval most likely to contain locus is between Xbcd1124 and Xcdo1173
Possible Orthologs
Xgwm273
Xgwm273-6B
gwm273
gwm273-1B
gwm273-6B



Locus for Probe
Xgwm273-6B
Type
Microsatellite
Chromosome
6B
Map
Ta-SSR-2004-6B41.5
[ Show Nearby Loci ]
Map Data
Wheat, Consensus SSR, 2004
Probe
WMS273
Reference
ReferenceSomers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114.
Possible Orthologs
Xgwm273
Xgwm273-1B
gwm273
gwm273-1B
gwm273-6B

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.