Query (optional)   in Class  

GrainGenes Marker Report: WMS480

[ Printable Version ]  [ Submit comment/correction ]

Probe
WMS480
Locus
Xgwm480-3A
Xgwm480
gwm480
gwm480-3A
Reference
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
Remarks
Insert contains repeat (CT)16(CA)13
PRIMER SEQUENCE IS AVAILABLE FOR PUBLIC RESEARCH ONLY. REQUESTS FOR COMMERCIAL USE SHOULD BE DIRECTED TO M. ROEDER.
Type
PCR
SSR
PCR primers
5' TGCTGCTACTTGTACAGAGGAC 3'
5' CCGAATTGTCCGCCATAG 3'
Amplification Conditions
3 min at 94 deg C; 45 cycles with 1 min at 94 deg C, 1 min at 60 deg C, and 2 min at 72 deg C; and a final extension step of 10 min at 72 deg C
Polymorphism
WMS480
Source Species
Triticum aestivum
Source Germplasm
Chinese Spring
Data Source
Roeder, Marion S.98.09.15



Locus for Probe
gwm480
Type
Microsatellite
Map
Durum Wheat, NSGC Lr 3A163.8
Wheat, Yr genes and QTL 3A76.1
Wheat_Consensus_2014_Ug99_Rust_3A138.53
[ Show Nearby Loci ]
Map Data
Durum Wheat, NSGC Lr
Wheat, Yr genes and QTL
Wheat_Consensus_2014_Ug99_Rust
Probe
WMS480
Possible Orthologs
Xgwm480
Xgwm480-3A
gwm480-3A



Locus for Probe
gwm480-3A
Type
Microsatellite
Map
Wheat-2014-Consensus-Ug99-Update_3A138.53
Wheat_AB, Ben x PI41025 3A188.4
Wheat_AB_2015_Consensus-3A163.8
[ Show Nearby Loci ]
Map Data
Wheat-2014-Consensus-Ug99-Update
Wheat_AB, Ben x PI41025
Wheat_AB_2015_Consensus
Probe
WMS480
Possible Orthologs
Xgwm480
Xgwm480-3A
gwm480



Locus for Probe
Xgwm480
Type
Microsatellite
Chromosome
3A
Map
Wheat-Composite2004-3A105
[ Show Nearby Loci ]
Map Data
Wheat, Composite, 2004
Probe
WMS480
Possible Orthologs
Xgwm480-3A
gwm480
gwm480-3A



Locus for Probe
Xgwm480-3A
Type
Microsatellite
Chromosome
3A
Chromosome Arm
3AL
3AS
Map
Chinese_Spring_Deletion_SSR_3A0.21
[ Show all 9 ]
[ Show Nearby Loci ]
Breakpoint Interval
C-3AL3-0.42
Map Data
T.dicoccoides, FHB QTL
[ Show all 9 ]
Probe
WMS480
Reference
ReferenceSomers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114.
ReferenceOtto CD et al. (2002) Genetic dissection of a major Fusarium head blight QTL in tetraploid wheat Plant Molecular Biology 48:625-632.
ReferenceSalina E et al. (2000) Microsatellite mapping of the induced sphaerococcoid mutation genes in Triticum aestivum Theoretical and Applied Genetics 100:686-689.
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
Data Source
Roeder, Marion S.98.09.15
Remark
In Map Ta-Synthetic/Opata-SSR-3A, the interval most likely to contain locus is between Xmwg30 and Xgwm162
Possible Orthologs
Xgwm480
gwm480
gwm480-3A