Query (optional)   in Class  

GrainGenes Marker Report: WMS499

[ Submit comment/correction ]

Probe
WMS499
Locus
Xgwm499-5B
[ Show all 7 ]
Reference
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
Remarks
Insert contains repeat (GA)32
PRIMER SEQUENCE IS AVAILABLE FOR PUBLIC RESEARCH ONLY. REQUESTS FOR COMMERCIAL USE SHOULD BE DIRECTED TO M. ROEDER.
Type
PCR
SSR
PCR primers
5' ACTTGTATGCTCCATTGATTGG 3'
5' GGGGAGTGGAAACTGCATAA 3'
Amplification Conditions
3 min at 94 deg C; 45 cycles with 1 min at 94 deg C, 1 min at 60 deg C, and 2 min at 72 deg C; and a final extension step of 10 min at 72 deg C
Polymorphism
WMS499
Source Species
Triticum aestivum
Source Germplasm
Chinese Spring
Data Source
Roeder, Marion S.98.09.15



Locus for Probe
gwm499
Type
Microsatellite
Map
Durum Wheat, NSGC Lr 5B90.7
Durum Wheat, NSGC Lr 5B74.9
Wheat, Yr genes and QTL 5B42.1
Wheat_Yr79_2018-5BS61.4
[ Show Nearby Loci ]
In QTL
QTgw.emmer2013-5B.1
Map Data
Durum Wheat, NSGC Lr
Wheat, Yr genes and QTL
Wheat_Yr79_2018
Probe
WMS499
Possible Orthologs
Xgwm499
[ Show all 6 ]



Locus for Probe
gwm499a-5B
Type
Microsatellite
Map
Wheat_AB, Langdon x G18-16 5B48.3
Wheat_AB_2015_Consensus-5B74.9
Wheat_Yr79_2018-5BS61.4
[ Show Nearby Loci ]
Map Data
Wheat_AB, Langdon x G18-16
Wheat_AB_2015_Consensus
Wheat_Yr79_2018
Probe
WMS499
Possible Orthologs
Xgwm499
[ Show all 6 ]



Locus for Probe
gwm499b-5B
Type
Microsatellite
Map
Wheat_AB, Kofa x UC1113 5B_149.7
Wheat_AB_2015_Consensus-5B90.7
Wheat_Yr79_2018-5BS61.4
[ Show Nearby Loci ]
Map Data
Wheat_AB, Kofa x UC1113
Wheat_AB_2015_Consensus
Wheat_Yr79_2018
Probe
WMS499
Possible Orthologs
Xgwm499
[ Show all 6 ]



Locus for Probe
gwm499a
Type
Microsatellite
Map
Wheat, Yr genes and QTL 5B43.8
Wheat_Yr79_2018-5BS61.4
[ Show Nearby Loci ]
Map Data
Wheat, Yr genes and QTL
Wheat_Yr79_2018
Probe
WMS499
Possible Orthologs
Xgwm499
[ Show all 6 ]



Locus for Probe
gwm499b
Type
microsatellite
Map
Wheat, Yr genes and QTL 5B48.8
Wheat_AB_2017_Carotenoid_QTL-5B90.7
Wheat_Yr79_2018-5BS61.4
[ Show Nearby Loci ]
Map Data
Wheat AB, Carotenoid QTL, 2017
Wheat, Yr genes and QTL
Wheat_Yr79_2018
Probe
WMS499
Possible Orthologs
Xgwm499
[ Show all 6 ]



Locus for Probe
Xgwm499
Type
Microsatellite
Chromosome
5B
Chromosome Arm
5BL
Map
Svevo/Ciccio-5B60.5
[ Show all 7 ]
[ Show Nearby Loci ]
Breakpoint Interval
5BL6-0.29-0.79
Map Data
Durum wheat, Svevo x Ciccio
[ Show all 7 ]
Probe
WMS499
Possible Orthologs
Xgwm499-5B
[ Show all 6 ]



Locus for Probe
Xgwm499-5B
Type
Microsatellite
Chromosome
5B
Chromosome Arm
5BL
Map
Chinese_Spring_Deletion_SSR_5B0.65
[ Show all 11 ]
[ Show Nearby Loci ]
Breakpoint Interval
5BL1-0.55-0.75
Map Data
Durum wheat, Kofa x UC1113
[ Show all 12 ]
Probe
WMS499
Reference
ReferenceSomers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114.
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
Data Source
Roeder, Marion S.98.09.15
Possible Orthologs
Xgwm499
[ Show all 6 ]

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.