Query (optional)   in Class  

GrainGenes Marker Report: WMS635

[Submit comment/correction]

Probe
WMS635
Locus
Xgwm635b-7A
[ Show all 14 ]
Reference
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
Remarks
Insert contains repeat (CA)10(GA)14
PRIMER SEQUENCE IS AVAILABLE FOR PUBLIC RESEARCH ONLY. REQUESTS FOR COMMERCIAL USE SHOULD BE DIRECTED TO M. ROEDER.
Type
PCR
SSR
PCR primers
5' TTCCTCACTGTAAGGGCGTT 3'
5' CAGCCTTAGCCTTGGCG 3'
Amplification Conditions
3 min at 94 deg C; 45 cycles with 1 min at 94 deg C, 1 min at 60 deg C, and 2 min at 72 deg C; and a final extension step of 10 min at 72 deg C
Polymorphism
WMS635
Source Species
Triticum aestivum
Source Germplasm
Chinese Spring
Data Source
Roeder, Marion S.98.09.15



Locus for Probe
gwm635
Type
Microsatellite
Map
Wheat, Yr genes and QTL 7D23.1
Wheat_Consensus_2014_Ug99_Rust_7D8.32
[ Show Nearby Loci ]
Map Data
Wheat, Yr genes and QTL
Wheat_Consensus_2014_Ug99_Rust
Probe
WMS635
Possible Orthologs
Xgwm635
[ Show all 13 ]



Locus for Probe
gwm635_1
Type
Microsatellite
Map
Wheat, Yr genes and QTL 7D22.6
Wheat_Consensus_2014_Ug99_Rust_7D117.9
[ Show Nearby Loci ]
Map Data
Wheat, Yr genes and QTL
Wheat_Consensus_2014_Ug99_Rust
Probe
WMS635
Possible Orthologs
Xgwm635
[ Show all 13 ]



Locus for Probe
gwm635a
Type
Microsatellite
Map
Wheat_Consensus_2014_Ug99_Rust_7A10.55
[ Show Nearby Loci ]
Map Data
Wheat_Consensus_2014_Ug99_Rust
Probe
WMS635
Possible Orthologs
Xgwm635
[ Show all 13 ]



Locus for Probe
gwm635_2
Type
Microsatellite
Map
Wheat, Yr genes and QTL 7A0.2
[ Show Nearby Loci ]
Map Data
Wheat, Yr genes and QTL
Probe
WMS635
Possible Orthologs
Xgwm635
[ Show all 13 ]



Locus for Probe
gwm635-7D.1
Type
Microsatellite
Map
Wheat-2014-Consensus-Ug99-Update_7D8.32
Wheat_Yr_2021-7D54.64
[ Show Nearby Loci ]
Map Data
Wheat, Yr Update, 2021
Wheat-2014-Consensus-Ug99-Update
Probe
WMS635
Remark
gwm635 has many versions and letter extensions in GrainGenes. gwm635-7D.1 and gwm635-7D.2 were renamed for position on the 7D map in GGG-5-449
Possible Orthologs
Xgwm635
[ Show all 13 ]



Locus for Probe
gwm635-7D.2
Type
Microsatellite
Map
Wheat-2014-Consensus-Ug99-Update_7D117.9
Wheat_Yr_2021-7D55.63
[ Show Nearby Loci ]
Map Data
Wheat, Yr Update, 2021
Wheat-2014-Consensus-Ug99-Update
Probe
WMS635
Remark
gwm635 has many versions and letter extensions in GrainGenes. gwm635-7D.1 and gwm635-7D.2 were renamed for position on the 7D map in GGG-5-449
Possible Orthologs
Xgwm635
[ Show all 13 ]



Locus for Probe
gwm635-7A
Type
Microsatellite
Map
Wheat-2014-Consensus-Ug99-Update_7A10.55
Wheat_Yr_2021-7A0.39
[ Show Nearby Loci ]
Map Data
Wheat, Yr Update, 2021
Wheat-2014-Consensus-Ug99-Update
Probe
WMS635
Possible Orthologs
Xgwm635
[ Show all 13 ]



Locus for Probe
Xgwm635
Type
Microsatellite
Chromosome
7A
Map
Ta-NxW-7A29.3
[ Show all 6 ]
[ Show Nearby Loci ]
Map Data
Wheat, Avalon x Cadenza
Wheat, Composite, 2004
Wheat, Nanda2419 x Wangshuibai
Wheat, WH542 x Synthetic
2 Point Data
Dn8/Xgwm635
Probe
WMS635
Possible Orthologs
Xgwm635-7A
[ Show all 13 ]



Locus for Probe
Xgwm635-7A
Type
Microsatellite
Chromosome
7A
Chromosome Arm
7AS
Map
Chinese_Spring_Deletion_SSR_7A-0.74
[ Show all 8 ]
[ Show Nearby Loci ]
Breakpoint Interval
7AS5-0.59-0.89
Map Data
Durum wheat, Kofa x UC1113
[ Show all 8 ]
Species
Triticum aestivum
Probe
WMS635
Reference
ReferenceSomers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114.
ReferencePaillard S et al. (2003) An integrative genetic linkage map of winter wheat (Triticum aestivum L.) Theoretical and Applied Genetics 107:1235-1242.
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
Data Source
Roeder, Marion S.98.09.15
Remark
In Map Ta-Synthetic/Opata-SSR-7A, the interval most likely to contain locus is distal to Xcdo545
Possible Orthologs
Xgwm635
[ Show all 13 ]



Locus for Probe
Xgwm635-7B
Type
Microsatellite
Chromosome
7B
Chromosome Arm
7BS
Map
Tt-Oxd-QTL-7B15.7
[ Show Nearby Loci ]
Map Data
T. turgidum, Omrabi5 x dicoccoides, QTL
Probe
WMS635
Possible Orthologs
Xgwm635
[ Show all 13 ]



Locus for Probe
Xgwm635-7D
Type
Microsatellite
Chromosome
7D
Chromosome Arm
7DS
Map
Chinese_Spring_Deletion_SSR_7D-0.805
Ta-SSR-2004-7D31.2
Ta-Synthetic/Opata-SSR-7D12.6
Triticum-AxF-7D12.6
[ Show Nearby Loci ]
Breakpoint Interval
7DS4-0.61-1.00
Map Data
Wheat, Arina x Forno
Wheat, Consensus SSR, 2004
Wheat, Physical, SSR
Wheat, Synthetic x Opata, BARC
Wheat, Synthetic x Opata, SSR
Species
Triticum aestivum
Probe
WMS635
Reference
ReferenceSomers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114.
ReferencePaillard S et al. (2003) An integrative genetic linkage map of winter wheat (Triticum aestivum L.) Theoretical and Applied Genetics 107:1235-1242.
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
Data Source
Roeder, Marion S.98.09.15
Remark
In Map Ta-Synthetic/Opata-SSR-7D, the interval most likely to contain locus is between Xbcd1975 and Xbcd588
Possible Orthologs
Xgwm635
[ Show all 13 ]



Locus for Probe
Xgwm635a
Type
Microsatellite
Chromosome
7D
Map
Wheat-Composite2004-7D119
[ Show Nearby Loci ]
Map Data
Wheat, Composite, 2004
Probe
WMS635
Possible Orthologs
Xgwm635
[ Show all 13 ]



Locus for Probe
Xgwm635a-7D
Type
Microsatellite
Map
CS/SQ1-7D3.3
[ Show Nearby Loci ]
Map Data
Wheat, Chinese Spring x SQ1
Probe
WMS635
Possible Orthologs
Xgwm635
[ Show all 13 ]



Locus for Probe
Xgwm635b-7A
Type
Microsatellite
Map
CS/SQ1-7A26.7
[ Show Nearby Loci ]
Map Data
Wheat, Chinese Spring x SQ1
Probe
WMS635
Possible Orthologs
Xgwm635
[ Show all 13 ]

GrainGenes is a product of the Agricultural Research Service of the US Department of Agriculture.