Query (optional)   in Class  

GrainGenes Marker Report: WMS636

[ Printable Version ]  [ Submit comment/correction ]

Probe
WMS636
Locus
Xgwm636-2A
Xgwm636
Reference
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
Remarks
Insert contains repeat (GA)28imp
PRIMER SEQUENCE IS AVAILABLE FOR PUBLIC RESEARCH ONLY. REQUESTS FOR COMMERCIAL USE SHOULD BE DIRECTED TO M. ROEDER.
Type
PCR
SSR
PCR primers
5' CGGTAGTTTTTAGCAAAGAG 3'
5' CCTTACAGTTCTTGGCAGAA 3'
Amplification Conditions
3 min at 94 deg C; 45 cycles with 1 min at 94 deg C, 1 min at 50 deg C, and 2 min at 72 deg C; and a final extension step of 10 min at 72 deg C
Polymorphism
WMS636
Source Species
Triticum aestivum
Source Germplasm
Chinese Spring
Data Source
Roeder, Marion S.98.09.15



Locus for Probe
Xgwm636
Type
Microsatellite
Chromosome
2A
Map
Svevo/Ciccio-2A8.4
Wheat-Composite2004-2A18
[ Show Nearby Loci ]
Breakpoint Interval
C-2AS5-0.78
Map Data
Durum wheat, Svevo x Ciccio
Wheat, Composite, 2004
Probe
WMS636



Locus for Probe
Xgwm636-2A
Type
Microsatellite
Chromosome
2A
Map
Chinese_Spring_Deletion_SSR_2A-0.89
[ Show all 7 ]
[ Show Nearby Loci ]
Breakpoint Interval
2AS5-0.78-1.00
Map Data
Durum wheat, Svevo x Ciccio
[ Show all 8 ]
Probe
WMS636
Reference
ReferenceSomers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114.
ReferenceRoder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
Data Source
Roeder, Marion S.98.09.15