Query (optional)   in Class  

GrainGenes Marker Report: XScm39

[ Printable Version ]  [ Submit comment/correction ]

Locus
XScm39
Type
Microsatellite
Chromosome
1R
Chromosome Arm
1RL
Map
Rye-2009-Consensus-1R37.5
Secale-PxP-update-1R70.2
[ Show Nearby Loci ]
Map Data
Rye, P87 x P105, update
Rye_2009_consensus
Probe
SCM39



Probe for Locus
SCM39
Locus
XScm39
Reference
ReferenceSaal B and Wricke G (1999) Development of simple sequence repeat markers in rye (Secale cereale L.) Genome 42:964-972.
General Remarks
Contains repeat (GT)8 (GC)6(GT)53
Primer pairs for microsatellite markers are available for academic use. Requests should be addressed to http://www.bafz.de/primer/start/php7
Type
PCR
SSR
PCR primers
5' GACCTCAGTGGAGCCTCTAGGT
3' GGACATCTGCCGTGACAATACC
SSR size
230
Amplification Conditions
Annealing temperature = 60 degrees C
Source Species
Secale cereale