Query (optional)   in Class  

GrainGenes Marker Report: Xabc153

[ Printable Version ]  [ Submit comment/correction ]

Locus
Xabc153
Type
RFLP
Map
Tm-Dubcovsky2-2A56.7
[ Show Nearby Loci ]
Map Data
T. monococcum, DV92 x G3116
Probe
ABC153
Possible Orthologs
ABC153



Probe for Locus
ABC153
Locus
ABC153
[ Show all 15 ]
External Databases
DDBJ
EMBL
GenBank
General Remarks
Steptoe malt cDNA
Type
cDNA
STS
PCR primers
GCC TCT GCC GCT GGA ACT AC
AAA CAC CTC CTG GCT CTC AG
STS primers
5' GGTTTGAGGACATGGTTGTTTC
5' GCCTCTGCCGCTGGAACTAC
STS size
ca. 330
Amplification Conditions
STS annealing temperature 52-55 oC
Sequence
L43924
ABC153
Linkage Group
Group 2
2
Source Species
Hordeum vulgare
Source Germplasm
Steptoe (barley)
Source Tissue
malt
Insert Size
0.4
Clone Vector
pBS
Excision Enzyme
EcoRI
Clone Location
GrainGenes Probe Repository
Kleinhofs, Andris
Clone Authority
Blake, Tom
Hayes, Patrick M.
Data Source
Blake, Tom95.08.24
ATMI92.09
Kleinhofs, Andris96.05.08
Kuenzel, Gottfried00.03